Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111468 Similarity: 0.923 Similarity: 0.920 Similarity: 0.912
UTR: 5HSAA111468
Gene: TMEM80_0
MFE: -105.307
ENS: 0.732
Length: 262.
Predicted Ligands:
cobalamin - 15/20
unknown - 4/20
FMN - 1/20
 RS: URS0000B89B9E_1658518
MFE: -98.595
Ligand: cobalamin
Species: Nitrospira sp. ND1 Cobalamin
 RS: URS0002323CF1_1089553
MFE: -110.605
Ligand: cobalamin
Species: Thermacetogenium phaeum DSM 12270 Cobalamin riboswitch
 RS: URS00023267AD_1839780
MFE: -96.105
Ligand: cobalamin
Species: Streptomyces sp. MnatMP-M17 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111468 URS0000B89B9E_1658518 URS0002323CF1_1089553 URS00023267AD_1839780
Length 262. 263. 262. 260.
Similarity - 0.923 0.920 0.912
Ensemble Norm 0.732 - - -
MFE -105.307 -98.595 -110.605 -96.105
Ligands - cobalamin cobalamin cobalamin
Gene TMEM80 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.001 21.001 27.001
Length SE - 1. 0. 4.
Lev Distance - 98. 97. 99.
UBS 22. 21. 21. 25.
BS 0. 0. 0. 0.
ILL 7. 7. 6. 9.
ILR 8. 8. 9. 6.
H 4. 5. 3. 3.
BL 9. 7. 5. 9.
BR 8. 6. 7. 11.
UN 0.061 0.030 0.084 0.031

Sequences

Field Description
UTR seq + 25 cuuagugccgcggguuucgcccguucccgccgccggcggaagccgagucagcccgaggccgagccgagacgagccgaauguccccgaggccgaaugcucccgaacgucgguucuccaccucuucccuuccgaaagugcccgagcggugccggacggacuaaucgggccucggccguggcucggacguccgcucccgaaacgcggcgcggucgggccccuucgucaggagacgcgaaaATGCTCCCGAACGTCGGTTCTCCAC
UTR dot + 25 ………((((((…))))))..(((((…)))))..(.((((…(((((..((((.((((.(..((((.(.(((((((((.((((((…..(((((..(((.((((..((((.(((.((((….))).)…))).))))..)))).)))…)))))..)))))).)))…))))))).))))……).)))).)))))))))…)))).).(((((..(((……………)))..)))))..
RS 1 seq UUGGAGAGCGGAGUGUCAGGAAGACGCCGUCAGCGUCGGGGAAGAUGGUGCAAAACCAUCACGGUGCCGCCACUGUAAGCGGGGAGUGACUCUGCAUUGAGCCACUGGCGAGUGGCGUGGUUCGUGAAUCGUAUCUCGUGAAGCGCAGGAGGUUCCCUCCGACCGUUUCACGAACGUCGUUUUACGUUUCACGCUCAGCUGGGAAGGCGCAGAGAAACGAUGAUCCGCAAGUCAGGAGACCCAACUGACGGGUUUGUAACUGA
RS 1 dot ((.((..((.(((((((…..)))))..)).)).)).))…((((((…..))))))((((((….))))))..(((((..(((.((((((…..(((.(((((..(.(((((((..((((((.((….((((((((((..(((((…)))))…))))))))))….)).))))))..)))))))).)))))…)))))))))…).))..)))))…((((.((((((…….))))))….))))
RS 2 seq UAAAUCCAUAUCCGGACAGGUGGCCUUUAGCAAUAAAGGCUGAAAAGGGAAACCGGUGCGAAUCCGGUGCGAUCGCGUCACUGUGAGGGGAAGCCCCCCUGCAAGGUGCCACUGUCCGACACUUGAUAUCCCGCGGAGGGCCGGAGCCGGCUCAAGAAGGCAUCCGCUCCCGACUGCAGAAGGGGAUAUUGGGUGCUGGAUGGGAAGGCGCAGGGUGGGAAUGCACCCGAGCCAGGAAACCUGCCUGUACCGGGGACACCGA
RS 2 dot ….(((……)))…..((((((((….))))))))…………(((((….(((((((((…(((((.((((..(((((..(((((((((…..(((.(((((((.(((((((((((((((((.(((.(((((((..(….)..))).))))..)))..))))…..))))))))))))).)))))))…))))))))).)))..).).)))..)).))))….))).)))))))))..))))).
RS 3 seq UAGGCUGGACACGCAGUCGGUUCGCGCUGUCCGCCAGGCAGCCGCGUCGUAAGAGGGAACCCGGUGGAAGUCCGGGACUGCCCCGCAGCGGUGAGUGGGAACGACCGCCGUCAUACGCACUGGACGCACCGCGUCCGGGAAGCGACGGUCAGUAGGAGCCUCGUACCGGUACGUACGUCAUACGUACGGCCAAUGGUUCACGGCCACGGCCACGAGGUGUGCCCACAAGUCCGAAGACCUGCCACUGCCCGUGUGCGAGC
RS 3 dot ..(((((……)))))….(((((((.((….)))))).)))(((((.(.(((….((((((..(((..((((((((.((..((.(((.((.(((((.(..(((((…(((…..((((….((((((((…((((.(((……..))))))).)))).)))).))))…))))))))…).)))).).))))).))..)).)))………)))))…)))…))))))))).).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table