Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111476 Similarity: 0.975 Similarity: 0.975 Similarity: 0.974
UTR: 5HSAA111476
Gene: TMEM86A
MFE: -50.844
ENS: 0.766
Length: 108.
Predicted Ligands:
TPP - 8/20
SAM - 8/20
fluoride - 1/20
 RS: URS0000ABC86A_1096856
MFE: -44.424
Ligand: TPP
Species: Pseudonocardia sp. EC080619-01 TPP riboswitch (THI element)
 RS: URS0000C0A16E_86668
MFE: -25.844
Ligand: TPP
Species: Bacillus niacini TPP riboswitch (THI element)
 RS: URS0000B53D34_1337886
MFE: -31.531
Ligand: SAM
Species: Sporomusa sphaeroides DSM 2875 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111476 URS0000ABC86A_1096856 URS0000C0A16E_86668 URS0000B53D34_1337886
Length 108. 108. 108. 108.
Similarity - 0.975 0.975 0.974
Ensemble Norm 0.766 - - -
MFE -50.844 -44.424 -25.844 -31.531
Ligands - TPP TPP SAM
Gene TMEM86A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.001 5.003 2.
Length SE - 0. 0. 0.
Lev Distance - 31. 32. 34.
UBS 8. 9. 8. 8.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 1.
ILR 1. 3. 2. 2.
H 3. 3. 3. 3.
BL 3. 3. 3. 3.
BR 1. 2. 3. 1.
UN 0.093 0.065 0.148 0.111

Sequences

Field Description
UTR seq + 25 gaaucgucgccggcuuaccuggccgugggcgcguccuggccgcugcagcccggagcagggugccagccgccgccgccgccgccATGGTGTCCCCGGTCACTGTGGTGA
UTR dot + 25 …….((.(((((…..)))))))((((.((…(((.((((..((((……))))..)))).)))))))))..((((((((((……..)))))))))).
RS 1 seq GAGAACCACGGGAGCCCGGCGAUCGGGCUGAGAGGGGACCAGGCGCGGUCCCGACCGUCGAACCUGAUCCGGGUCAUGCCGGCGCAGGGAGCGAGGUGGCAGAUCCAU
RS 1 dot …..((…..((((((…..))))))….))(((.((((((((((….)))).))..)))).)))(((((.(((((.(((…..)))…))))))))))..
RS 2 seq UACUAGCACUGGGGGAGCCGGAAUUGGCUGAGAUUAGACUUGUAGUGGUCUUAAACCCCUGAACCUGAUCUGGGUUAUACCAGCGUAGGGAAGUGAACGAUCCAAUGC
RS 2 dot ……..((((…..))))…(((((.(((((((…..(((.(((…..))).)))…))))))).)))))…..((((.(((..(….)..))).))))
RS 3 seq UACUCAUCAAGAGUUGGUGGAGGGACUGGCCCGAUGAAACCGCGGCAACCAUUUAGUAGUUUUACUAAAAACGGUGCCAAUUCCGGCGGAUAAACCGCAAGAUGGGAG
RS 3 dot …(((((..(.((((((……))))))).)))))……(((.(((.(((((((….)))))))…))))))..(((((((((…..))))….))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table