Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111480 Similarity: 0.952 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA111480
Gene: TMEM87A
MFE: -52.422
ENS: 0.899
Length: 184.
Predicted Ligands:
cobalamin - 12/20
lysine - 4/20
Mg2+ - 3/20
 RS: URS0002323437_520762
MFE: -40.612
Ligand: cobalamin
Species: Thermotalea metallivorans Cobalamin riboswitch
 RS: URS00023338E9_706587
MFE: -43.788
Ligand: cobalamin
Species: Desulfomonile tiedjei DSM 6799 Cobalamin riboswitch
 RS: URS0000C1B7CB_1629716
MFE: -69.342
Ligand: lysine
Species: Peptococcaceae bacterium BRH_c4a Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111480 URS0002323437_520762 URS00023338E9_706587 URS0000C1B7CB_1629716
Length 184. 184. 184. 185.
Similarity - 0.952 0.951 0.951
Ensemble Norm 0.899 - - -
MFE -52.422 -40.612 -43.788 -69.342
Ligands - cobalamin cobalamin lysine
Gene TMEM87A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.004 15. 10.
Length SE - 0. 0. 1.
Lev Distance - 59. 57. 59.
UBS 18. 16. 17. 16.
BS 0. 0. 0. 0.
ILL 5. 6. 8. 7.
ILR 7. 5. 5. 6.
H 1. 1. 1. 1.
BL 6. 5. 6. 7.
BR 7. 7. 6. 7.
UN 0.005 0.065 0.011 0.022

Sequences

Field Description
UTR seq + 25 gacgacugucugagagaggggccgcuacgccgcacagcaaacaagcuccgcgacguuuccaggacccggauaaucccgcccuuagagcagagccggaagaaggcgggacgaaccggaagagggugaaaugcuuucgguaggcacuccacggcugugaagATGGCACATTCCGATACCGTCGTTG
UTR dot + 25 ((((((((((.(.(((.(..((((((……((((((……((((((.(((((((((…..((((….((((((((((.(.((…)))..)))..)))))))….))))……).)))))).)).)))..)))……..)))))).)).)))).).))))))))..)))))).
RS 1 seq UUUAUUGCGAAUUCAUUAGGUACUCUUUAGGAGUUUAAUAGGGAAGUUCGGUGAAAGUCCGACACAGCCCCCGCUACUGUAAGUGAGGAUGAAAUCGACCAUAUGUCACUUGUAUGCUACAGGGAAGACGUCGAGAGUAAAGGGAUUCACGAGUCAGGAGACCUGCCUAAUGAUGCACUCACUG
RS 1 dot …..((((…((((((((((.(((((..((.((……………((((((.((((((.(..(((..(((((…((((((.((((……..))).).))))))))).))….)))..)..)))).)).)…….))))))).)).)))))..))))))))))))))…….
RS 2 seq GUUAAGGUUCAGUAAUUGGGCUAUCCUAAAAAUCAGGAUUUUAGGGAAAACGGUGCAAAUCCGUUGCGGACCCGCCGCUGUAACCGGGGAUGAAAGCCGCAAUACCACUGUCAAUUCUUGAUGGGAAGGGCGGCGAGUAAAACGAACCGGAAGCCAGAAGACCUGCCCAUGGGAGCUAUAGCGU
RS 2 dot ((((.(((((..((..(((((………….(((.((((..((….((((…..(.((((….((.(((((((.(..((((((((((.((………..)).))).))))…)))..).))))))).))..)))))))))….))..)))))))))))))).))))).))))..
RS 3 seq GAGUGGGGUAGAGGCGCGGUAACGCAUGAGUAAUCCCGGUGAGGAAGGUACCGAUGAUCCGGGGCCAAGGGGCUUACCGCCGAAGUUGCGGCUGACCAUACAGCCGCUGCUGGGCCGUCGCCGAACAGGUGCCGGACUGUCAUCCGAAAACAUUCCCAGCUUUCGGAUGAAGCGCUAUCUCAUCU
RS 3 dot ..(((((((…(((((..(…………((((.(((..((((.((.(.((((((((((.(((….(((..((.(((..(((.(((((((……))))))).))).))).)).)))…..))).)))))…))))).)…)).))))..)))…)))))..))))))))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table