Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111669 Similarity: 0.953 Similarity: 0.953 Similarity: 0.952
UTR: 5HSAA111669
Gene: TMPRSS11B
MFE: -19.022
ENS: 0.860
Length: 161.
Predicted Ligands:
glucosamine - 11/20
cobalamin - 6/20
TPP - 2/20
 RS: URS0002315E3D_696747
MFE: -38.643
Ligand: cobalamin
Species: Arthrospira platensis NIES-39 Cobalamin riboswitch
 RS: URS000009A3A5_35824
MFE: -38.758
Ligand: cobalamin
Species: Arthrospira sp. Cobalamin
 RS: URS0000BE41A6_520767
MFE: -63.918
Ligand: glucosamine
Species: Thermovenabulum sp. R270 glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111669 URS0002315E3D_696747 URS000009A3A5_35824 URS0000BE41A6_520767
Length 161. 161. 162. 162.
Similarity - 0.953 0.953 0.952
Ensemble Norm 0.860 - - -
MFE -19.022 -38.643 -38.758 -63.918
Ligands - cobalamin cobalamin glucosamine
Gene TMPRSS11B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.022 8.021 10.033
Length SE - 0. 1. 1.
Lev Distance - 62. 59. 60.
UBS 8. 8. 8. 10.
BS 0. 1. 1. 0.
ILL 2. 2. 2. 2.
ILR 1. 2. 3. 2.
H 2. 3. 3. 3.
BL 3. 2. 2. 3.
BR 3. 3. 2. 5.
UN 0.335 0.186 0.191 0.154

Sequences

Field Description
UTR seq + 25 agcacauaagucaaaagcugcgucagaagguucuaacuuuugucaucacuauuaccagcauugucaucguuaucguuaucuucgucaucaucauuaccaccguuauaccugauacugccauaacaaucagaacauuATGTACAGGCACGGCATATCTTCCC
UTR dot + 25 ………(.(((..((((.((((((((…….))))))………..)))))).))).)…………………………….((((….((((.(((…………………..))))))).))))………..
RS 1 seq AUAAUAGCCAAAACUAUAGGUUCUAGUGGGGAACAGCCACUAGGAGUAAUGGGGAAAGUUCGGUGUAAAUCCGGCACUGUCCCGCAACUGUAAUCAGAUUUAAGGCAAAUUUUUCCACCCAAUCUGUGAGUCAGGAUGCCCGCCUAUAGUUAUUUCUCACU
RS 1 dot ………..((((((((((((((((((…….)))))))))……((((.(((((((…….)))).))).))))(((.(((….((((((…((…………)).))))))…..)))..)))…)))))))))……….
RS 2 seq ACAAUAGCGCCAACUAUAGGUUCUAGUGGGGAACAGCCACUAGGAGUAAUGGGGAAAGUUCGGUGUAAAUCCGGCGCUGUCCCGCAACUGUAAUCAGAUUUCCGGCUAAUUUGUCCACCCCAUCUGUGAGUCAGGAUGCCCGCCUAUAGUUAUUUCUCACUC
RS 2 dot ………..((((((((((((((((((…….)))))))))……((((.(((((((…….)))).))).))))(((.(((….(((((….(((……)))……)))))…..)))..)))…)))))))))………..
RS 3 seq UAAAAUCAAAAAGCGCCUGAGCUUGAAAGGGACCUUCCUUUUAAGCUGACGAGGAUGGGGUUUAUCGAGAAUUCGGCGGGUGCCCCACGGAGCCUGCCCUCCGAAGGAAGCCUACAAAACCGGCAAGCGAUUGCCGGGACAAAGGGGCUUCCAGGCAGAAAG
RS 3 dot ……….((((.(((.((((((((((((….)))))))))))).)…….)).))))………..(((((((.((….)).)))))))((((…((((((((……(((((((….)))))))…….)))))))).)).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table