Detected as a riboswitch by 5 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111670 Similarity: 0.957 Similarity: 0.947 Similarity: 0.946
UTR: 5HSAA111670
Gene: TMPRSS11B_0
MFE: -24.943
ENS: 0.809
Length: 187.
Predicted Ligands:
cobalamin - 16/20
glucosamine - 1/20
Mn2+ - 1/20
 RS: URS0000BE2EF7_640938
MFE: -54.474
Ligand: glucosamine
Species: Trichococcus sp. R210 glmS glucosamine-6-phosphate activated ribozyme
 RS: URS00022F9B03_52694
MFE: -41.631
Ligand: cobalamin
Species: Acetobacterium wieringae Cobalamin
 RS: URS0002314EBB_619805
MFE: -35.541
Ligand: cobalamin
Species: Soonwooa buanensis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111670 URS0000BE2EF7_640938 URS00022F9B03_52694 URS0002314EBB_619805
Length 187. 186. 185. 185.
Similarity - 0.957 0.947 0.946
Ensemble Norm 0.809 - - -
MFE -24.943 -54.474 -41.631 -35.541
Ligands - glucosamine cobalamin cobalamin
Gene TMPRSS11B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5.010 16. 10.019
Length SE - 1. 4. 4.
Lev Distance - 55. 58. 62.
UBS 9. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 3. 2. 2.
ILR 3. 3. 2. 1.
H 3. 4. 6. 4.
BL 2. 3. 1. 3.
BR 2. 1. 1. 2.
UN 0.262 0.161 0.270 0.

Sequences

Field Description
UTR seq + 25 aaaaaccaagcuccaacacuggauguagcacauaagucaaaagcugcgucagaagguucuaacuuuugucaucacuauuaccagcauugucaucguuaucguuaucuucgucaucaucauuaccaccguuauaccugauacugccauaacaaucagaacauuATGTACAGGCACGGCATATCTTCCC
UTR dot + 25 …………………((((((((………….)))))))).((((((..((((…((.((…((……))…)).))..))))…..))))))…………….((((….((((.(((…………………..))))))).))))………..
RS 1 seq AGCAAACGGAUAGCGCCAGACUUCAGGGAGCACAGGAACAACGGCCCUGAAGUGACGAGGAUUGGGUUUAUCGAAGAUUCGGCGGAUGACCCAAGGCACGUGUAGUCUACAGGAUUGAAGCAAAAAAGACCCUUCUGCGGCCCGAGCGCCCGGAUCGGUCUUACAGAGAUCAAUCCCCACACCCAG
RS 1 dot …….((……))..(((((((((…………….))))))))).(((.(..(((((.(((((…………))))))))))..).)))……….(((((((…….((((((..((((.(((……)))))))..))))))…….)))))))……….
RS 2 seq AAUCAAAUCAGAAAUAGAGGUGGCUGGCAAAAAUUUGUCGGCAUAAUAGGGAAACAGGUGAAAAUCCUGUACGGUACCGCCGCUGUGUAAGAAGAGUUUUUCCAGGAAUACCACUGGUCAUUCGGGAAGGUAGGAAAAAUGAAGACGCUUGAGUCAGAAAACCUGCCUGUAUGGAUAUUCAUUAU
RS 2 dot ………………….((((((((….))))))))………..(((((…….))))).((((…))))((.(……).))…..((((……..))))..(((((…(((((((………(((……)))……)))))))…)))))………
RS 3 seq ACAUAUUUUUGCAAAAUUGGUUUUCGGGCUUAAUAACCCGAAAUUAAAAGGGAAUCGAAGUGUAAGUCUUCAACUGUCCCCGCAACUGUAGAUCGUAUAAAGAGAUUGCAUCAAGACCAUUGUCGCCGACGAGAAGGGGUGUAAUCAACGAAAGUCAGGAGACCUGCCAAAUUUAACUUAACAAA
RS 3 dot …………………(((((((……..)))))))……((((…((((…….))))…..))))…………………..(((((((((….((.((.(((….))).)))))))))))))…….(.((((…)))).)……………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table