Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111672 Similarity: 0.977 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA111672
Gene: TMPRSS11D
MFE: -10.215
ENS: 0.902
Length: 90.
Predicted Ligands:
TPP - 11/20
glycine - 5/20
Ni/Co - 1/20
 RS: URS0000C86E28_1629
MFE: -18.957
Ligand: TPP
Species: Weissella viridescens TPP riboswitch (THI element)
 RS: URS0000C549D3_759620
MFE: -23.734
Ligand: TPP
Species: Weissella sp. 1119-1A-09 TPP riboswitch (THI element)
 RS: URS0000DB20E7_1660087
MFE: -27.455
Ligand: glycine
Species: Acidovorax sp. SCN 68-22 Glycine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111672 URS0000C86E28_1629 URS0000C549D3_759620 URS0000DB20E7_1660087
Length 90. 89. 89. 89.
Similarity - 0.977 0.975 0.975
Ensemble Norm 0.902 - - -
MFE -10.215 -18.957 -23.734 -27.455
Ligands - TPP TPP glycine
Gene TMPRSS11D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 6.002 9.
Length SE - 1. 1. 1.
Lev Distance - 28. 30. 29.
UBS 5. 6. 6. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 3.
ILR 3. 2. 2. 2.
H 2. 3. 3. 2.
BL 2. 1. 1. 2.
BR 0. 1. 1. 0.
UN 0.044 0.090 0.090 0.022

Sequences

Field Description
UTR seq + 25 auuugagugggaaucucaaagcaguugaguaggcagaaaaaagaaccucuucauuaaggauuaaaATGTATAGGCCAGCACGTGTAACTT
UTR dot + 25 .((((((…….))))))..(((((.((.(((………….((((…..))))………….)))…))…))))).
RS 1 seq UCAACCAUGCUGGGGUGCCAAACGGCUGAGAUAAUACCCACAAACCUGAUCCAGAUAAUACUGGCGGAGGAAGCUUGGUUUUGUUUACG
RS 1 dot …(((…….)))(((….)))..((((((.(((……(((…((((……))))…)))……))).))))))…
RS 2 seq UCGACCAUGCUGGGGUGCCGAAAGGCUGAGAUAAUACCCAUGAACCUGAUCCAGUUAGUACUGGCGUAGGAAGCUUGGUUUUGUUUAUU
RS 2 dot …(((…….)))(((….)))..((((((.(((……((((..(((((….)))))..))))……))).))))))…
RS 3 seq CUCGCCGGCGCAGGAGAGCGCACGCGCCACGCGUGCCACCGAAGGCGCAAACUCCCAUGAACGCUCAGGUACCGUACUGCCCACCGUGG
RS 3 dot ..(((..((((……))))..)))(((((.(((……..((((…….((.(((….)))))……..))))))))))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table