Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111673 Similarity: 0.972 Similarity: 0.970 Similarity: 0.968
UTR: 5HSAA111673
Gene: TMPRSS11D_0
MFE: -15.833
ENS: 0.822
Length: 124.
Predicted Ligands:
TPP - 16/20
molybdenum - 2/20
glycine - 1/20
 RS: URS0000AB1A14_767817
MFE: -33.855
Ligand: molybdenum
Species: Desulfotomaculum gibsoniae DSM 7213 Moco (molybdenum cofactor) riboswitch
 RS: URS0000C1A9C4_1129794
MFE: -32.021
Ligand: TPP
Species: Paraglaciecola psychrophila 170 TPP riboswitch (THI element)
 RS: URS0000DB3C1D_40578
MFE: -32.312
Ligand: TPP
Species: Xenorhabdus beddingii TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111673 URS0000AB1A14_767817 URS0000C1A9C4_1129794 URS0000DB3C1D_40578
Length 124. 123. 123. 125.
Similarity - 0.972 0.970 0.968
Ensemble Norm 0.822 - - -
MFE -15.833 -33.855 -32.021 -32.312
Ligands - molybdenum TPP TPP
Gene TMPRSS11D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 4. 18.012
Length SE - 1. 1. 1.
Lev Distance - 36. 38. 36.
UBS 6. 6. 7. 8.
BS 0. 0. 0. 0.
ILL 3. 2. 3. 2.
ILR 4. 3. 3. 2.
H 2. 3. 3. 3.
BL 1. 1. 1. 3.
BR 0. 0. 1. 2.
UN 0.234 0.252 0.220 0.344

Sequences

Field Description
UTR seq + 25 acuauagaucacacguaauacaugagagucauucauuugagugggaaucucaaagcaguugaguaggcagaaaaaagaaccucuucauuaaggauuaaaATGTATAGGCCAGCACGTGTAACTT
UTR dot + 25 ………………….(((((.((((((….))))))…)))))..(((..((….(((………….((((…..))))………….)))..))..)))…..
RS 1 seq ACAUUUUUAUUUUUCCGAAUCUGUUCGCCUGUAGUCAAUAAGACUAUGGCGGCGAAUCUAUACAUGGUGCGCCUGGAAACGGGCUGGCCUCCCAUUGUGGAAAGGAGCCUUCAUUAUCUGGAC
RS 1 dot ………………….(((((((.((((((…..))))))…)))))))……..(((..(((((….)))))..)))(((….(((((……..)))))…..))).
RS 2 seq UUUUUCUUGUCGGAGUGCUAGUGUUUUUUACUGAGGUGAAAAACAUAAGCUGAGACCGUUAAUUCGGGAUCCGUUGAACCUGAUCGGGCUAGUACCCGCGAAGGAAACAAGCGUAAUGUUAUU
RS 2 dot …………….(((.(((((((((((….))))))))))).))).((..(((……)))..))((((…(((…((((……))))…)))…..))))……….
RS 3 seq UUUUUCUUGUCGGAGUGCCUAGCGUUCAACGUGUAUCACGAUGGACACAGGCUGAGACCGUUUAUUCGGGAUCCGCAGAACCUGAUCGGGCUAAUACCCGCGAAGGGAACAAGAGUAAUCACCCC
RS 3 dot …………….((((.(.(((((.((((…)))).))))).))))).((..(((……)))..))…….(((…((((……))))…)))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table