Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111778 Similarity: 0.964 Similarity: 0.963 Similarity: 0.961
UTR: 5HSAA111778
Gene: TMTC3
MFE: -35.784
ENS: 0.927
Length: 154.
Predicted Ligands:
FMN - 9/20
SAM - 7/20
glycine - 1/20
 RS: URS0000C27F88_1262892
MFE: -33.778
Ligand: glycine
Species: Eubacterium sp. CAG:76 Glycine riboswitch
 RS: URS0000ABCAEA_633697
MFE: -46.680
Ligand: FMN
Species: Eubacterium cellulosolvens 6 FMN riboswitch (RFN element)
 RS: URS0000C5E878_1736413
MFE: -51.240
Ligand: SAM
Species: Nocardioides sp. Soil797 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111778 URS0000C27F88_1262892 URS0000ABCAEA_633697 URS0000C5E878_1736413
Length 154. 154. 153. 153.
Similarity - 0.964 0.963 0.961
Ensemble Norm 0.927 - - -
MFE -35.784 -33.778 -46.680 -51.240
Ligands - glycine FMN SAM
Gene TMTC3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.026 7.015 4.035
Length SE - 0. 1. 1.
Lev Distance - 44. 45. 49.
UBS 10. 8. 10. 11.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 3. 3. 2. 3.
H 3. 3. 5. 4.
BL 4. 3. 3. 4.
BR 3. 1. 3. 2.
UN 0.331 0.169 0.209 0.144

Sequences

Field Description
UTR seq + 25 augcaacgcguaagacugcgacgguaccggggcggcggggaaggaccgagaggcgggaggagcagcggcucaggcgccugcaaacugguggccugaacgaguuuuuguccagaagugcuuauagaaaagATGGCTAATATTAACCTAAAAGAAA
UTR dot + 25 ……………((((..((….))..))))(((…….)))..((((((((.(((.(((.(.(((((((((……..)))).))))).)..)))))).)))…..)))))…………………………….
RS 1 seq GAUCGACUCUCUGGAGAGUUCUGGAUAAACACAGAGGCCGAAGGUGCAACAUAUAGUUCUUUAUAAGCAGUUAAUAAUGGAUUACAAGACAAUAUUAUGACUUCUUAUAAAGAGGGUAUAUGAAUCUCUCAGGCAAAAGGACAGAGAAGGCAUA
RS 1 dot ……((((….))))(((((……..)))))(((..(((…..((((((.(((((((((((.((((.((((((………….)))))))))).)))))))))))..))))))….)))..)))………………..
RS 2 seq AACGAACUUCAGGGCAGGGUGAAAUUCCCGAUCGGCGGUAAAGUCCGCAAGCCUUGUGCAACGUUUCUGAACCUACAGUUUUGAACGCUGCAUCGGGCAGACCCGGUGAGAUUCCGGGACCGACAGUAUAGUCUGGAUGGAAGAAGAAUCGUU
RS 2 dot …………((..(((…….)))..)).((((……))))..((((.(((((.(((((..((((…..)))).))))).))))).))))…(((((…….))))).(((.(((……)))..)))………….
RS 3 seq AGCUCAUCGAGAGGGACUGAGGGAACGGCCCAGUGAAGUCCCGGCAACCGCCACGAGCCCCCUGCUCCGCCCACCAGAAACCCGGGCGGGACCAGUCGUGGAAACGGUGCUAAUUCCGGCCCACGGCGAGAUACGACGCGGGGAAGAUGAGAA
RS 3 dot ..(((…))).((((((..(((…..)))…..))))))(((.((((((((((…..(((.(((((((………..)))))))..)))))))))…)))))))……..(((.((.((…..)).)).)))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table