Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111794 Similarity: 0.985 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA111794
Gene: TMX2
MFE: -24.482
ENS: 0.977
Length: 74.
Predicted Ligands:
fluoride - 8/20
cobalamin - 4/20
homocysteine - 3/20
 RS: URS0000BE3266_411467
MFE: -20.832
Ligand: fluoride
Species: Pseudoflavonifractor capillosus ATCC 29799 Fluoride riboswitch
 RS: URS0000D94B23_418702
MFE: -19.272
Ligand: homocysteine
Species: Azonexus hydrophilus S-adenosyl-L-homocysteine riboswitch
 RS: URS0000DA1B78_1834191
MFE: -10.532
Ligand: fluoride
Species: Enterococcus sp. 8G7_MSG3316 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111794 URS0000BE3266_411467 URS0000D94B23_418702 URS0000DA1B78_1834191
Length 74. 75. 75. 73.
Similarity - 0.985 0.985 0.984
Ensemble Norm 0.977 - - -
MFE -24.482 -20.832 -19.272 -10.532
Ligands - fluoride homocysteine fluoride
Gene TMX2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.003 2.001 3.
Length SE - 1. 1. 1.
Lev Distance - 18. 19. 19.
UBS 5. 6. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 3. 3. 3.
ILR 1. 1. 1. 2.
H 1. 1. 1. 1.
BL 1. 2. 1. 1.
BR 2. 3. 1. 1.
UN 0.108 0.160 0.080 0.123

Sequences

Field Description
UTR seq + 25 ggggcgagaccuacgacgccggcgagcaguggccguuacggccgaaaagATGGCGGTCTTGGCACCTCTAATTG
UTR dot + 25 (((.(((((((……((((……..(((((…..)))))……))))))))))).).))……..
RS 1 seq GUGAAUCAGGGGAAUGAAGUGCUCCCCGGGGCGUGGCCCCGAACCGCGUUUGACGCUGAUGACUUCUGCAUUUUG
RS 1 dot ((..(((((.(…(.((((((….((((((…))))))….)))))).)).))))).))…………
RS 2 seq CCUGCCGAGGAGCGCUGCGACCACUUUGAAUAAAAUGGGGCCAGGCUCGGCAAUGAUCAACGGCGCUCGCAAACC
RS 2 dot ..(((….((((((((……..((((……(.((((…)))).)……)))))))))))))))….
RS 3 seq GGAGAAUAGGGGAAUGAAUGUCUCCCUCAGUGAUUACUGAAACCGCAAUUUUGCUAAUGACUUCUACAAGCUU
RS 3 dot ((((..(((.(((((…(((…..(((((….)))))….)))))))).)))….))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table