Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111796 Similarity: 0.972 Similarity: 0.971 Similarity: 0.971
UTR: 5HSAA111796
Gene: TMX2_0
MFE: -35.832
ENS: 0.994
Length: 121.
Predicted Ligands:
TPP - 10/20
SAM - 6/20
FMN - 2/20
 RS: URS0000AB7E38_1670800
MFE: -46.422
Ligand: TPP
Species: Mesorhizobium sp. B7 TPP riboswitch (THI element)
 RS: URS0000DAEDF4_797419
MFE: -26.299
Ligand: SAM
Species: Aequorivita sp. 8-1b SAM riboswitch (S box leader)
 RS: URS0000DA8840_1122930
MFE: -34.197
Ligand: TPP
Species: Papillibacter cinnamivorans DSM 12816 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111796 URS0000AB7E38_1670800 URS0000DAEDF4_797419 URS0000DA8840_1122930
Length 121. 122. 121. 119.
Similarity - 0.972 0.971 0.971
Ensemble Norm 0.994 - - -
MFE -35.832 -46.422 -26.299 -34.197
Ligands - TPP SAM TPP
Gene TMX2 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.006 7. 3.
Length SE - 1. 0. 4.
Lev Distance - 33. 36. 33.
UBS 7. 9. 9. 7.
BS 0. 0. 0. 0.
ILL 3. 1. 2. 3.
ILR 2. 2. 2. 1.
H 2. 3. 3. 2.
BL 1. 2. 1. 2.
BR 2. 2. 3. 1.
UN 0.182 0.107 0.182 0.168

Sequences

Field Description
UTR seq + 25 guacguuugcgauauagcccaauagcagucguuauggugggggaggcggggcgagaccuacgacgccggcgagcaguggccguuacggccgaaaagATGGCGGTCTTGGCACCTCTAATTG
UTR dot + 25 ……………..(((((((((….)))))..))))(((((…(.(((((((……((((……..(((((…..)))))……))))))))))).).)))))…..
RS 1 seq CUCGCUCUAACGGGGUGCCGGAGGUCCUUGGACUUUCCGGCUGAGAGGCGAAGGGUUUUCCCUGCCAACCCGCUGAACCUGAUCCGGUUUGUACCGGCGGAGGGAUUAGACGCUCGCAAAUG
RS 1 dot ((((……))))..((((((((((….))))).)))))……(((.((.(((((((((……((((((((((……))))…..)))))))))))..)))).)))))…..
RS 2 seq AUGUUAUCAAGAAAGGCCGAGGGAUUAGACCCUAUGACGCCUUAGCAACCCUUUCUCCGGAAUGAAGGUGCUACAUUCUACAACGAUCGCGACAAUUAUCGAGAUCAACGAUAGAUAACGA
RS 2 dot …………(((((((((((……)))).))..)))))((((…(((((……..)))))))))….(((((…((((.(((……))).))))…).))))……
RS 3 seq AACUUAACACAGGGGUGCUGGAAGUCAUUUCCGGCUGAGAGGAAAGCAAAUGGCAGCUUUUAAACCCUUAAACCUGAUCCGGGUAAUGCCGGCGUAGGAAGAGCGUUCUUGUUUCUUCA
RS 3 dot …………….(((((((…..)))))))…((((.((((((..(((.((((((………..((((..((((……))))..))))))))))))).)))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table