Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111840 Similarity: 0.989 Similarity: 0.987 Similarity: 0.987
UTR: 5HSAA111840
Gene: TNFAIP6
MFE: -4.781
ENS: 0.929
Length: 63.
Predicted Ligands:
fluoride - 20/20 - 20/20


 RS: URS0000D99685_1297750
MFE: -15.073
Ligand: fluoride
Species: Bacteroides luti Fluoride riboswitch
 RS: URS0000BF3B9D_343509
MFE: -7.507
Ligand: fluoride
Species: Sodalis glossinidius str. 'morsitans' Fluoride riboswitch
 RS: URS0000C02A84_399741
MFE: -9.901
Ligand: fluoride
Species: Serratia proteamaculans 568 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111840 URS0000D99685_1297750 URS0000BF3B9D_343509 URS0000C02A84_399741
Length 63. 63. 64. 63.
Similarity - 0.989 0.987 0.987
Ensemble Norm 0.929 - - -
MFE -4.781 -15.073 -7.507 -9.901
Ligands - fluoride fluoride fluoride
Gene TNFAIP6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 2.051 3.
Length SE - 0. 1. 0.
Lev Distance - 14. 16. 17.
UBS 3. 3. 4. 2.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 2. 3. 3. 2.
BL 1. 0. 1. 0.
BR 1. 0. 1. 0.
UN 0.524 0.460 0.297 0.540

Sequences

Field Description
UTR seq + 25 agccccuaacaggcuguuacuucacuacaacugacgauATGATCATCTTAATTTACTTATTTC
UTR dot + 25 ((((…….))))……………..((.(((…))).))…………….
RS 1 seq GCCUGUUUUGGCAAUGGCAUCUGCCUUAAACCGCUCAAUUGAGCUGAUGAUACCUACUUAAAG
RS 1 dot (((……)))…(((….)))…….((((….))))……………….
RS 2 seq CUUUCCCCAGGAGAUGAAAUUACUCUUUAUAACCGCCGCUCUGGCUGAUGAUGUCUACGUUCAU
RS 2 dot .(((((…)))))………………(.(((…..))).)((((………))))
RS 3 seq UCGAACGACGGAGAUGACAUUCCUCCUUAACCGCCUUCACGGGCUGAUGAUGUCUACGUAACC
RS 3 dot ………((((………))))……((((….))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table