Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111872 Similarity: 0.969 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA111872
Gene: TNFRSF10D
MFE: -36.939
ENS: 0.772
Length: 117.
Predicted Ligands:
TPP - 8/20
SAM - 6/20
zmp-ztp - 3/20
 RS: URS0000DAE44A_643674
MFE: -38.553
Ligand: TPP
Species: Paenalcaligenes hominis TPP riboswitch (THI element)
 RS: URS0000D9579E_1121131
MFE: -34.577
Ligand: FMN
Species: Butyrivibrio fibrisolvens DSM 3071 FMN riboswitch (RFN element)
 RS: URS0000C13FC5_1660166
MFE: -45.993
Ligand: TPP
Species: Rhodospirillales bacterium SCN 65-16 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111872 URS0000DAE44A_643674 URS0000D9579E_1121131 URS0000C13FC5_1660166
Length 117. 117. 118. 118.
Similarity - 0.969 0.969 0.968
Ensemble Norm 0.772 - - -
MFE -36.939 -38.553 -34.577 -45.993
Ligands - TPP FMN TPP
Gene TNFRSF10D - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.001 7.012 4.007
Length SE - 0. 1. 1.
Lev Distance - 39. 38. 41.
UBS 9. 8. 10. 9.
BS 0. 0. 0. 0.
ILL 1. 1. 2. 2.
ILR 1. 1. 2. 2.
H 3. 3. 3. 4.
BL 4. 3. 4. 3.
BR 1. 3. 3. 1.
UN 0.154 0.179 0.042 0.068

Sequences

Field Description
UTR seq + 25 aguguagcugcgagaaccuuugcacgcgcacaaacuacggggacgauuucugauugauuuuuggcgcuuucgauccacccuccucccuucucATGGGACTTTGGGGACAAAGCGTCC
UTR dot + 25 .((((.((((((((….)))))).))))))……((((((…))))))……….((((((((.(.(((.((….((((…….))))….)))))))))))))).
RS 1 seq GAUGGCACGCGGGGGUACUGCUUGCCUACGGAUACUCUGCAUCUAGGCAUUCGGUUGAGAUAAACCCUUCGUACCAGUACGGAUAAUGCCGAUGCUGGGAGCGUGUCACAGCCUAGC
RS 1 dot …((((.((((…..)))).))))………..(((……)))…(((((.((((…….(((.(((((((((……))).))))))..))))))).)))))….
RS 2 seq AUAUUGCUUCGGGGUUGGGUGUGAUUCCCUACCGGCGGUAUAGUCCGCGAGCUGAUUUUCAGCAUGAACCGGUGUGAUUCCGGUACCGACAGUAAAGUCUGGAUGGUAGAAGCGCAGG
RS 2 dot ((((((((….(((.(((…….))).)))))))))))…(((((.(((((…))))).))…)))((((.(((…(((((.(((……)))..)))))))).))))..
RS 3 seq AUGACGUCCGAGGGGUGUCCGGUUUCCAGCGUGGAACCGGGCUGAGACAGCCGCAGCGGCUGAACCCUUUGAACCUGAUCCGGAUCAUGCCGGCGAAGGAACGGGAGUCAGUCGUGGA
RS 3 dot ..((((.((….))))))(((((((……)))))))(((((…)))))…((((((((.(((.((…(((…((((……))))…))))).)))..))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table