Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111882 Similarity: 0.984 Similarity: 0.984 Similarity: 0.984
UTR: 5HSAA111882
Gene: TNFRSF13B
MFE: -12.838
ENS: 0.991
Length: 67.
Predicted Ligands:
fluoride - 19/20
unknown - 1/20

RS: URS0000BE7B78_521011
MFE: -17.739
Ligand: fluoride
Species: Methanosphaerula palustris E1-9c Fluoride riboswitch
RS: URS0000D81E6E_1150368
MFE: -18.683
Ligand: fluoride
Species: Sinomicrobium oceani Fluoride riboswitch
RS: URS0000C44379_1660091
MFE: -16.047
Ligand: fluoride
Species: Bordetella sp. SCN 67-23 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111882 URS0000BE7B78_521011 URS0000D81E6E_1150368 URS0000C44379_1660091
Length 67. 67. 67. 66.
Similarity - 0.984 0.984 0.984
Ensemble Norm 0.991 - - -
MFE -12.838 -17.739 -18.683 -16.047
Ligands - fluoride fluoride fluoride
Gene TNFRSF13B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.018 6.001 0.
Length SE - 0. 0. 1.
Lev Distance - 17. 19. 20.
UBS 5. 3. 4. 5.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 3. 3. 3.
BL 2. 0. 1. 2.
BR 2. 0. 0. 2.
UN 0.134 0.269 0.164 0.136

Sequences

Field Description
UTR seq + 25 agcacuaaucaaaucuaagacuaguaauaagcauccugaguaATGAGTGGCCTGGGCCGGAGCAGGC
UTR dot + 25 …((((.((……..)).))))……(((.(……..).)))(((((……..)))))
RS 1 seq CUUCGUCAGGGUGAUGGGGUUCACCCACAAUAAACCGCGUUUCUUCGCUGAUGACCCCUAUCCAUCA
RS 1 dot ……..((((((……))))))……….(((……)))(((((………)))))
RS 2 seq AAAAUCAGUGGCAAUGGUGUCUGCCCUGAACCGCCCUUUUACAAGGGAUAAUGGCGCCUGUUAUCGU
RS 2 dot ….((((.((((……..))))))))…..((((….))))((((((((…))))))))..
RS 3 seq UAUGUUCCUGGAGAUGGCAUUCCUCCAUGAACCGCCGCGCAAGCAGCUGAUGAUGCCUACAGAUCC
RS 3 dot …((((.(((((………))))).)))).((.((….)).))….(((……..))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table