Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA111883 Similarity: 0.986 Similarity: 0.985 Similarity: 0.984
UTR: 5HSAA111883
Gene: TNFRSF13B_0
MFE: -12.838
ENS: 0.991
Length: 68.
Predicted Ligands:
fluoride - 18/20
SAM - 2/20

 RS: URS0000D906DE_1434701
MFE: -7.268
Ligand: fluoride
Species: Chishuiella changwenlii Fluoride riboswitch
 RS: URS0000C34223_1120926
MFE: -9.295
Ligand: fluoride
Species: Acinetobacter gerneri DSM 14967 = CIP 107464 Fluoride riboswitch
 RS: URS0000DB13D1_1855339
MFE: -21.246
Ligand: fluoride
Species: Nitrosovibrio sp. Nv17 Fluoride riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA111883 URS0000D906DE_1434701 URS0000C34223_1120926 URS0000DB13D1_1855339
Length 68. 69. 68. 68.
Similarity - 0.986 0.985 0.984
Ensemble Norm 0.991 - - -
MFE -12.838 -7.268 -9.295 -21.246
Ligands - fluoride fluoride fluoride
Gene TNFRSF13B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.007 12.014 3.011
Length SE - 1. 0. 0.
Lev Distance - 16. 16. 20.
UBS 5. 4. 3. 4.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 3. 3. 3.
BL 2. 0. 0. 1.
BR 2. 1. 0. 1.
UN 0.147 0.232 0.265 0.250

Sequences

Field Description
UTR seq + 25 aagcacuaaucaaaucuaagacuaguaauaagcauccugaguaATGAGTGGCCTGGGCCGGAGCAGGC
UTR dot + 25 ….((((.((……..)).))))……(((.(……..).)))(((((……..)))))
RS 1 seq AACAAAAUAGGAAAUGGUGUUCUUCCUAAACCAAACCGCUUUAUAAUAGCUGAUGACGCCUGAUUAUUA
RS 1 dot …….((((((………))))))………(((…….)))(((((((….).))))))
RS 2 seq UAAAUUAAAGGAAAUGGCUAUCUUCCUUCUACAAACCGCCACUAACGGCUGAUGAUACCUACGUUACC
RS 2 dot …….((((((………))))))………(((……)))(((((…….)))))..
RS 3 seq UUCCCCCACGGAGAUGGCAUGCCUCCGACAACCGCCGCGCCCGCGCGGCUGAUGAUGCCUACGCAACA
RS 3 dot ……..(((((………)))))……((((((….))))))…((.(((….))).))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table