Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112082 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA112082
Gene: TNNI3K
MFE: -7.003
ENS: 0.972
Length: 76.
Predicted Ligands:
cobalamin - 18/20
Ni/Co - 2/20

 RS: URS0000BF329A_1765722
MFE: -32.527
Ligand: cobalamin
Species: Streptomyces silvensis Cobalamin riboswitch
 RS: URS0000C514A7_1470557
MFE: -39.849
Ligand: cobalamin
Species: Streptomyces sp. Tu 6176 Cobalamin riboswitch
 RS: URS0000DB2FF8_1048205
MFE: -36.749
Ligand: cobalamin
Species: Streptomyces uncialis Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112082 URS0000BF329A_1765722 URS0000C514A7_1470557 URS0000DB2FF8_1048205
Length 76. 76. 76. 76.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.972 - - -
MFE -7.003 -32.527 -39.849 -36.749
Ligands - cobalamin cobalamin cobalamin
Gene TNNI3K - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2. 2. 2.
Length SE - 0. 0. 0.
Lev Distance - 20. 20. 20.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 0.
ILR 0. 0. 0. 0.
H 3. 3. 3. 3.
BL 0. 1. 1. 1.
BR 1. 1. 1. 1.
UN 0.197 0.197 0.197 0.197

Sequences

Field Description
UTR seq + 25 aaucuuauaacuugaagaacugcccuggagaaaggaagaaacuuauaauaaATGGGAAATTATAAATCTAGACCAA
UTR dot + 25 ..((((……..))))…..(((……))).(((…(((((((………))))))).)))…….
RS 1 seq GGGGAAUCUGGUGCGAAUCCAGAGCUGACGCGCAGCGGUGUGGUCCGGCGAGGUGCCGGGCCGAGCCCGAAUGCCC
RS 1 dot ……(((((…….)))))((((…..))))(((.(((((((((…..))))))))).)))………
RS 2 seq GGGGAACCCGGUGGGAGUCCGGGGCUGACGCGCAGCGGUGUGGGGCGGCGGGAGGCCGCCCCGAGCCCGAAUGCCC
RS 2 dot ……(((((…….)))))((((…..))))(((.(((((((((…..))))))))).)))………
RS 3 seq GGGGAACCCGGUGGGAGUCCGGGGCUGACGCGCAGCGGUGUGGGACGGCAGGGGGCCGUCCCGAGCCCGAAUGCCC
RS 3 dot ……(((((…….)))))((((…..))))(((.(((((((((…..))))))))).)))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table