Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112083 Similarity: 0.991 Similarity: 0.991 Similarity: 0.991
UTR: 5HSAA112083
Gene: TNNI3K_0
MFE: -5.137
ENS: 0.938
Length: 41.
Predicted Ligands:
SAM - 14/20
zmp-ztp - 2/20
preQ_1 - 2/20
RS: URS00023316D7_471853
MFE: -15.636
Ligand: zmp-ztp
Species: Beutenbergia cavernae DSM 12333 ZMP/ZTP riboswitch
RS: URS0000BE9AC2_1514904
MFE: -10.827
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
RS: URS0000BE9632_1514904
MFE: -10.995
Ligand: SAM
Species: Ahrensia marina SAM riboswitch (alpha-proteobacteria)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112083 URS00023316D7_471853 URS0000BE9AC2_1514904 URS0000BE9632_1514904
Length 41. 41. 41. 41.
Similarity - 0.991 0.991 0.991
Ensemble Norm 0.938 - - -
MFE -5.137 -15.636 -10.827 -10.995
Ligands - zmp-ztp SAM SAM
Gene TNNI3K - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 2.001 2.001
Length SE - 0. 0. 0.
Lev Distance - 11. 12. 12.
UBS 3. 3. 2. 2.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 2. 1. 1. 1.
H 1. 2. 1. 1.
BL 0. 0. 0. 0.
BR 0. 0. 0. 0.
UN 0.220 0.195 0.244 0.244

Sequences

Field Description
UTR seq + 25 cagggaagguggggcuATGGGAAATTATAAATCTAGACCAA
UTR dot + 25 …….((((((..(((((….)))))..)))..)))..
RS 1 seq GUCGCGACUGGCGCCGAGGUGGAUCACCACCGGGGAGCGAC
RS 1 dot ..(((…..)))((..(((((….)))))..))……
RS 2 seq GUUAUUCAUUGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 2 dot ……….(((((…..((((….))))….)))))
RS 3 seq AAUAGAUUUCGUGGUGAUUUGGCCGGUCGGCUUGCAGCCAC
RS 3 dot ……….(((((…..((((….))))….)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table