Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112297-1 Similarity: 0.983 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA112297-1
Gene: TOM1
MFE: -34.520
ENS: 0.979
Length: 96.
Predicted Ligands:
glycine - 13/20
TPP - 5/20
purine - 1/20
 RS: URS0000D7C649_252474
MFE: -38.648
Ligand: glycine
Species: Thioalkalivibrio halophilus Glycine riboswitch
 RS: URS0000C3F0DE_1231350
MFE: -40.088
Ligand: glycine
Species: Acidisphaera rubrifaciens HS-AP3 Glycine riboswitch
 RS: URS0000AB6405_518637
MFE: -15.933
Ligand: TPP
Species: Eubacterium biforme DSM 3989 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112297-1 URS0000D7C649_252474 URS0000C3F0DE_1231350 URS0000AB6405_518637
Length 96. 97. 95. 97.
Similarity - 0.983 0.980 0.979
Ensemble Norm 0.979 - - -
MFE -34.520 -38.648 -40.088 -15.933
Ligands - glycine glycine TPP
Gene TOM1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4. 8.007 10.001
Length SE - 1. 1. 1.
Lev Distance - 20. 23. 23.
UBS 7. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 3. 2. 2. 2.
H 2. 2. 3. 2.
BL 3. 2. 2. 3.
BR 2. 2. 0. 4.
UN 0.229 0.216 0.147 0.258

Sequences

Field Description
UTR seq + 25 gagcuucgcggugccaccgccccgcccacgccuccucgccggccuccgagugcgucacgugacgggucgguATGGAGATCTGCGACATCATCAACG
UTR dot + 25 …….((((.((….)).))))…(((((((..((((((((.((.(((…))).))..))))))))..))))….)))…………
RS 1 seq CUCUGGAGAGCGGCCGGCAGACGGCCCACCGAAGGGGGCGAUCGCCCGGGUCCACAAGGACCGCGGGGCGCGCAAACUCUCAGGUUUCAGGACAGAG
RS 1 dot ………(.(((((…..))))))(((..((((.(((..(((((((((((….))))).)))).)))))…))))..)))…………
RS 2 seq AUCUGGAGAGAGGCGCGACCGUGCGCCCGCCGAAGGGGACGCCCGAUCAACGCCGCACGGCGUGACGGGCCAAGCUCUCAGGCACCGUGACAGAU
RS 2 dot .(((….)))((((((….)))))).(((..((((…(((((.((.(((((….))))))))))))….))))..)))…………
RS 3 seq UAAAUAAAUCUGGGGAGCUAUUGCUGAGAGGAAGUACGACUUCGACCCAUUAAACCUGACGGAUAAUGCCGGCGUAGGAAGUAUAGAUGUUUUUUUG
RS 3 dot ……..(((.((.(…..).)).)))….((((..(((((.(((((((..((….)).)))))..)))).)))..))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table