Detected as a riboswitch by 3 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112400 Similarity: 0.958 Similarity: 0.951 Similarity: 0.951
UTR: 5HSAA112400
Gene: TOP3B
MFE: -59.164
ENS: 0.764
Length: 183.
Predicted Ligands:
cobalamin - 13/20
FMN - 3/20
Mn2+ - 3/20
 RS: URS0000D95654_1797542
MFE: -66.842
Ligand: FMN
Species: Candidatus Buchananbacteria bacterium RIFCSPHIGHO2_02_FULL_56_16 FMN riboswitch (RFN element)
 RS: URS0000ABD5A7_757424
MFE: -94.416
Ligand: Mn2+
Species: Herbaspirillum seropedicae SmR1 yybP-ykoY manganese riboswitch
 RS: URS0000D7C210_1851577
MFE: -75.706
Ligand: Mn2+
Species: Variovorax sp. JS1663 yybP-ykoY manganese riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112400 URS0000D95654_1797542 URS0000ABD5A7_757424 URS0000D7C210_1851577
Length 183. 182. 184. 182.
Similarity - 0.958 0.951 0.951
Ensemble Norm 0.764 - - -
MFE -59.164 -66.842 -94.416 -75.706
Ligands - FMN Mn2+ Mn2+
Gene TOP3B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7. 7.009
Length SE - 1. 1. 1.
Lev Distance - 54. 61. 61.
UBS 12. 12. 11. 14.
BS 0. 0. 0. 0.
ILL 1. 0. 2. 2.
ILR 3. 2. 3. 4.
H 4. 4. 4. 4.
BL 4. 5. 2. 4.
BR 4. 4. 3. 5.
UN 0.131 0.159 0.125 0.038

Sequences

Field Description
UTR seq + 25 gaaauagggguugucgguagccgccccgggaacaaggaccggagcuggauccgcggugcggcuguggcauugguaauagugcugugcugcggaagaguggagucuaaacuuuuucauugccagugccccgaaacuggagugugaaggaccgagacaaaATGAAGACTGTGCTCATGGTTGCTG
UTR dot + 25 ……(((((((….))))).))((((………))))…….((((((((((((((((.((….)).)))..))))))))))))).(((((.(((((..((((((.((((.(((((……..))))))))).)))))…………)..))))).)))))……….
RS 1 seq AAGCAUUCUUCGGGGCGGGGUGGAACUCCCCACCGGCGGUAUAGCCCGCGACCCCCUCCCUUUCUGCAUACCCGUUUUUAUACAGAAAGAGAGGGGCUGAACUGGUGCCCGGCUUUCGCUGAAGCUUCAGCGAGGCGAGAAUUCCAGUGCCGACGGUAUAGUCCGGAUGGAAGAAGAUGCGA
RS 1 dot ……….(((((.(((((…))))))).)))((((……))))…((((((.(((((((.(((……..))).))))))).))))))(((.(((.((((((((((((((((((….)))))))))………….))))..)))))))).)))…………….
RS 2 seq AAUGCGGCCUUCUCUUUGGGGAGUAGCCAGCUUCCGGAUCAUCCGGAAGAGCCCGUGUCAACAUUCUCGGCAGCAGCAGCUGCCGUGGCGCGGGUAGCCAAUCGGUAGGCGAGACCAUAGACGUUUCCUGCGGCCAGGCUGGGCGCGCAGGCGCGUCCAUGGACUUUUCGCCCGGCCAAGGAAU
RS 2 dot …..(((((((((…))))))..)))..((((((((…)))))))).((((((((((…….(((((((….)))))))))))))))))……..(((.(((((((((((.(((((..(((((((((……))).)))))).))))).))))…)))))))..)))…….
RS 3 seq CCACCGGUCAUUGGGGAGUAGCCGCCUUCCAUUGCGAGAAGGGUGUGCGUCAACAGACUUGUCCGGCUUCGUGCGGGACAUGGCGCAGACAGUGUUCCACCUGGCGAGACCUUUGACCGUGCAACUUCGGGUGUGGCCGAAGGUGUUGCACGGUCAAUUGCGUUCUCUUCGGCCCAAGGAAU
RS 3 dot ….((((.(((….))).))))(((((……..)))))((.(((((((…….(((((.((…..)).)))))))))))).))…(((((….(((((((((.((((((((((((((((((……)))))…)))))))))))))..).)).)))….)))…)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table