Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112507 Similarity: 0.980 Similarity: 0.976 Similarity: 0.976
UTR: 5HSAA112507
Gene: TOR1A
MFE: -46.768
ENS: 0.815
Length: 102.
Predicted Ligands:
purine - 9/20
TPP - 6/20
homocysteine - 2/20
 RS: URS0000D6808F_428128
MFE: -29.627
Ligand: tetrahydrofolate
Species: [Eubacterium] siraeum DSM 15702 THF riboswitch
 RS: URS0000DA3E8B_199441
MFE: -23.729
Ligand: TPP
Species: Bacillus krulwichiae TPP riboswitch (THI element)
 RS: URS0000C731A0_1123367
MFE: -50.053
Ligand: homocysteine
Species: Thauera linaloolentis 47Lol = DSM 12138 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112507 URS0000D6808F_428128 URS0000DA3E8B_199441 URS0000C731A0_1123367
Length 102. 101. 100. 101.
Similarity - 0.980 0.976 0.976
Ensemble Norm 0.815 - - -
MFE -46.768 -29.627 -23.729 -50.053
Ligands - tetrahydrofolate TPP homocysteine
Gene TOR1A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.002 7.001 4.
Length SE - 1. 4. 1.
Lev Distance - 25. 25. 30.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 0. 1. 0. 1.
ILR 0. 0. 2. 0.
H 3. 3. 4. 2.
BL 6. 5. 5. 6.
BR 3. 2. 2. 2.
UN 0.098 0.139 0.130 0.089

Sequences

Field Description
UTR seq + 25 gaaccggaagcgugggucuggcggcugcaccgguucgcggucggcgcgagaacaagcaggguggcgcggguccgggcATGAAGCTGGGCCGGGCCGTGCTGG
UTR dot + 25 …(((……))).(((.((.((((.((((…..)))))))))).)))…..(((.(((((.(.(((((((……..))))))).)))))).))).
RS 1 seq CGACAGAGUAGGUUAACGUGCGUAAAGUGCCUGAGGGACGGGGAGUUGUCCUCAGGACGAACACUGAAAGGUGGCGGUACGUUUUCCGCAUCUCGCUGUUG
RS 1 dot …….(((.(….).)))…..((.(((((.((((((….))))))))))))).((((.(((..(((.((((……..)))))))))).)))).
RS 2 seq UAAAUCCACUAGGGGUGUCAUUUGACUGAGAGAGGUGAAUCCUCAACUCUAAAUACCUGAUCUAGUUCAUACUAGCGUAGGGAAGUGGCUCGGUAAUCGA
RS 2 dot …((((…..))))(((….))).(((.((((…..))))..)))….((((.((.(((.(((.(((….)))..))).))).))))))…..
RS 3 seq UCUUCCGAGGAGCGCUGCGAGGCGCCGGGCAAUUCAGCCCAGGCCCCCAGGCUCGGAAACCCGCGGGCAAGCCGCCGCGGUUCGAACGGCGCUCGCCCGAA
RS 3 dot ..((((…((((.(((.(.((.(((((((……)))).)))))))))))))))))…..(((((.((.(((((………))))))).)))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table