Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112679 Similarity: 0.979 Similarity: 0.979 Similarity: 0.978
UTR: 5HSAA112679
Gene: TP63
MFE: -18.
ENS: 0.967
Length: 114.
Predicted Ligands:
TPP - 20/20 - 20/20


 RS: URS0000BEF9C6_1300222
MFE: -34.726
Ligand: TPP
Species: Brevibacillus borstelensis AK1 TPP riboswitch (THI element)
 RS: URS0000AB785B_322104
MFE: -23.297
Ligand: TPP
Species: Scheffersomyces stipitis CBS 6054 TPP riboswitch (THI element)
 RS: URS0000C6FFE7_1635290
MFE: -29.383
Ligand: TPP
Species: Parcubacteria bacterium 33_209 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112679 URS0000BEF9C6_1300222 URS0000AB785B_322104 URS0000C6FFE7_1635290
Length 114. 113. 113. 113.
Similarity - 0.979 0.979 0.978
Ensemble Norm 0.967 - - -
MFE -18. -34.726 -23.297 -29.383
Ligands - TPP TPP TPP
Gene TP63 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 0.002 5.001
Length SE - 1. 1. 1.
Lev Distance - 25. 27. 27.
UBS 6. 8. 6. 7.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 3.
ILR 2. 2. 2. 1.
H 2. 2. 2. 2.
BL 2. 1. 2. 1.
BR 2. 2. 2. 1.
UN 0.254 0.257 0.212 0.221

Sequences

Field Description
UTR seq + 25 cccggcuuuauaucuauauauacacagguauauguguauauuuuauauaauuguucuccguucguugauaucaaagacaguugaaggaaATGTTGTACCTGGAAAACAATGCCC
UTR dot + 25 ……………..(((((((((……)))))))))……..((((((.((((..((((..(.((((……)))).)..))))…….)))).))))))….
RS 1 seq AAAAGUAACUGGGGGAGUCCAUCUUGCUGGGCUGAGAGGACGGAAGCGAUGACCGUCGACCCUUUGCACCUGAUCCAGAUCAUGCUGGCGCAGGGAAGUGGUUACAGGCGGAU
RS 1 dot …………….((((.((((((…)).))))))))………..(((((((((((((…((((..((((……))))..)))))))).))))…)))))..
RS 2 seq AAUUGAAACUUGCGGGUGUCCCCCCAUUUCUUAUUUGAAAUAGGUGGACUGAGAACAUACCGUUUGAACUCGAUCAAGCUAACACUUGCGUGAGGAAGUUUUAUUGUUCAGUA
RS 2 dot ……………..((((.((.(((((……))))).)).))))…(((((………..((((..((((……))))..))))……….)))))….
RS 3 seq UAUUAUUUAUGGGGGAGCCUGUAUGUAAUCAGGCUGAGAAAAGAAUGGCAUUUCUUGACCCUUAGAACCUGAACUGGUUAAUACCAGCGGAGGGAAAUGUAAAUGCUAUCGAA
RS 3 dot ……………((((((……..))))))…….(.((((((((((….((((……(((..(((((….))))))))))))….).))))))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table