Detected as a riboswitch by 16 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112773 Similarity: 0.977 Similarity: 0.977 Similarity: 0.977
UTR: 5HSAA112773
Gene: TPK1
MFE: -26.869
ENS: 0.895
Length: 106.
Predicted Ligands:
TPP - 14/20
SAM - 2/20
zmp-ztp - 2/20
 RS: URS0000D94E06_1121476
MFE: -13.507
Ligand: purine
Species: Dethiosulfatibacter aminovorans DSM 17477 Purine riboswitch
 RS: URS0000D9DEED_399497
MFE: -38.568
Ligand: TPP
Species: Tessaracoccus flavescens TPP riboswitch (THI element)
 RS: URS0000AB863C_879243
MFE: -23.103
Ligand: SAM
Species: Porphyromonas asaccharolytica DSM 20707 SAM-I/IV variant riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112773 URS0000D94E06_1121476 URS0000D9DEED_399497 URS0000AB863C_879243
Length 106. 105. 107. 105.
Similarity - 0.977 0.977 0.977
Ensemble Norm 0.895 - - -
MFE -26.869 -13.507 -38.568 -23.103
Ligands - purine TPP SAM
Gene TPK1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 8.002 3. 1.002
Length SE - 1. 1. 1.
Lev Distance - 26. 29. 30.
UBS 9. 8. 9. 9.
BS 0. 0. 0. 0.
ILL 5. 3. 4. 5.
ILR 4. 3. 5. 4.
H 2. 2. 2. 2.
BL 2. 1. 2. 1.
BR 1. 2. 2. 1.
UN 0.075 0.114 0.093 0.114

Sequences

Field Description
UTR seq + 25 aaagcuuuuaacccgacggcucagggaggacaccgguagcaggacuagaagcagcacaguggaaaaggccaauaauccguuATGGAGCATGCCTTTACCCCGTTGG
UTR dot + 25 …(((((((..((..(.(((..((…….))))).)..))..)))))))….((((((.((((((..((..(((…..)))..))))))))…)))))).
RS 1 seq UUGAGAAAUCAUUGCACCACUCGUAUAAAUUUGAUGAUAUGGAUCAAAUGUUUCUACCAAACUACCUUAAAAUAGUUACAGGCUACGAGUUCUUUAUUCUUAAGG
RS 1 dot …((((((..(((..(((.((((………))))..)))..)))..))))))………(((((((((((….(((((…))).))))))).))))))
RS 2 seq GAAGCCACACAGGGGAGCGCCUCGAGGCGCUGAGAGUGCGGACAGAGCCGCAGACCCUCAAACCUGAUCCGGCUAGCACCGGCGUAGGGAGUGGGACCUCCCCGGCA
RS 2 dot ….((.(((…..((((((….))))))….))).))…..((((..(((((.(…((((..((((……))))..))))..).)))…))..)))).
RS 3 seq AGUUAGCAUUAAGAGCCGGUCUACGGACCGCCCCAACCGAGCCUUGCAUAAUGGUCACGGUGGGAAGAAUGGAUGCGAAUUAGACGUUUAACCUAUAAACCAACU
RS 3 dot …..(((…((.((((((….((….))…)))).)))))))….((((….(((((..(((((..((…..))..)))))..)))))..))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table