Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112818 Similarity: 0.959 Similarity: 0.954 Similarity: 0.952
UTR: 5HSAA112818
Gene: TPM3
MFE: -52.687
ENS: 0.889
Length: 155.
Predicted Ligands:
FMN - 7/20
cobalamin - 5/20
glycine - 4/20
 RS: URS0002327EFF_1817772
MFE: -40.436
Ligand: cobalamin
Species: Candidatus Lambdaproteobacteria bacterium RIFOXYD2_FULL_50_16 Cobalamin riboswitch
 RS: URS0000C4AED0_1196322
MFE: -27.319
Ligand: glycine
Species: Clostridium sp. Maddingley MBC34-26 Glycine riboswitch
 RS: URS0000AB7AE5_290399
MFE: -57.695
Ligand: FMN
Species: Arthrobacter sp. FB24 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112818 URS0002327EFF_1817772 URS0000C4AED0_1196322 URS0000AB7AE5_290399
Length 155. 155. 155. 155.
Similarity - 0.959 0.954 0.952
Ensemble Norm 0.889 - - -
MFE -52.687 -40.436 -27.319 -57.695
Ligands - cobalamin glycine FMN
Gene TPM3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.011 4.001
Length SE - 0. 0. 0.
Lev Distance - 54. 61. 62.
UBS 13. 12. 13. 13.
BS 0. 0. 0. 0.
ILL 3. 4. 3. 4.
ILR 3. 3. 2. 3.
H 2. 2. 3. 1.
BL 6. 5. 7. 5.
BR 5. 5. 5. 6.
UN 0.052 0.077 0.155 0.013

Sequences

Field Description
UTR seq + 25 gucacauccgggcggguuggugaguuccgguauuucagggcguagcaggcggaaguaagggugagaggaggcugcaacgccgagcggaggaggcaggaaccggagcgcgagcaguagcugggugggcaccATGGCTGGGATCACCACCATCGAGG
UTR dot + 25 (((.(((((((((..(((.((..((((((((.((((..(((((.((((.(……………….).)))).)))))..)……….))).)))))))))).))).))..))))))))))…((((.(((…..)))))))…..
RS 1 seq AUUGACAAUCUAGUUUCGAGUGCUCAAGUUACUAGUUCCAGGAGGAAGUAGGGUGCGAAUCCCUCACUGGCGCGCAACGGUGAUGCAGCUUGCUGACAAGUCCGAUCUUCCCUCAUCCUCGCGUACAGGAGACUUGCCAGGGCUUGCCCGGGAAU
RS 1 dot ………(.((((((..((((.(.((…..((…..((((((((((((.((((……((((((……..)))))))))).))))))………..))))))))….)).).))))..)))))).)((.(((….))).))…
RS 2 seq GGAUGAACCCUUGGAGAGACUCAAAAGCACAAUUGAAAAAAUAAUAAACCAGAAUAUUUGCAUAUUUGGUCUAGUAUUUUUUAUGUGCGGAAAUGGAGCACCGAAGGAGAAAGCGUAAAUGCGAAACUCUCAGGUAAAAGGACAGGGGAAAGGUA
RS 2 dot ……..((((.(.(.(.(((….(((((….((((((((.((.(((((.((((….))))))))).)).)))))))).)))))…….)))).)).))))…..((……))…..((((..((……))..))))……
RS 3 seq CUACGUGCUCCGGGGUCGGUGUAAGUCCGAACCGGCGGUGACAGUCCGCGACCCGCGAGCCGGCACAGAUCCUCUCCAGGAACUGUUCCGGCGGACGGUUGAACCGGUGAAAUUCCGGUACCGACAGUUAAAGUCUGGAUGAGAGAAGCACGUAC
RS 3 dot .((((((((((((((((((((…..(((((.((.((((..(((.(((…((…..(((((.((((.((((….)))).)))).))))))).)))))).)))).))…))).)))))))))……..))))))……..))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table