Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112874 Similarity: 0.972 Similarity: 0.970 Similarity: 0.969
UTR: 5HSAA112874
Gene: TPM3_0
MFE: -27.936
ENS: 0.844
Length: 112.
Predicted Ligands:
TPP - 14/20
SAM - 2/20
tetrahydrofolate - 2/20
 RS: URS0000DA229A_1805077
MFE: -41.488
Ligand: TPP
Species: Chloroflexi bacterium 13_1_40CM_4_68_4 TPP riboswitch (THI element)
 RS: URS0000C7ACBB_1736324
MFE: -35.122
Ligand: TPP
Species: Aeromicrobium sp. Leaf289 TPP riboswitch (THI element)
 RS: URS0000C6B044_1869
MFE: -42.038
Ligand: TPP
Species: Actinoplanes utahensis TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112874 URS0000DA229A_1805077 URS0000C7ACBB_1736324 URS0000C6B044_1869
Length 112. 110. 111. 111.
Similarity - 0.972 0.970 0.969
Ensemble Norm 0.844 - - -
MFE -27.936 -41.488 -35.122 -42.038
Ligands - TPP TPP TPP
Gene TPM3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.004 4. 3.
Length SE - 4. 1. 1.
Lev Distance - 32. 38. 39.
UBS 9. 9. 9. 10.
BS 0. 0. 0. 0.
ILL 1. 2. 0. 0.
ILR 1. 2. 0. 1.
H 4. 4. 5. 5.
BL 4. 3. 3. 4.
BR 3. 3. 3. 3.
UN 0.143 0.082 0.162 0.126

Sequences

Field Description
UTR seq + 25 agcaggcggaaguaagggugagaggaggcugcaacgccgagcggaggaggcaggaaccggagcgcgagcaguagcugggugggcaccATGGCTGGGATCACCACCATCGAGG
UTR dot + 25 .((((.(……………….).))))…(((……….)))…….((.((.((..(((…)))..)).)).))((((.(((…..)))))))…..
RS 1 seq AUUGGCGGCUGGCGGAGCUCGCGAGAGCUGAGAGUGGGCCGGAAUGAAGGCCCAGACGCCACGAACCUGAUCCGGGUAAUGCCGGCGGAGGGAAGCAUGAGCACCUCUAC
RS 1 dot .(((((..((.(((…..))).)).)))))…((((((……..))))))..((((.((.(((((…)))))..))..))))((((…((….)).))))…
RS 2 seq CCACCACGACAGGGGAGCGCCGCCGCAGAGGGCGCUGAGAGUGCGGAUCAGCCGCAGACCCUUGAACCUGCUCCGGUUAGCACCGGCGAAGGGAGUCACGAUGAGUUCUGC
RS 2 dot ((.((……))))((((((………))))))…..(((((…..)))))……….(((.(.(((((….))))).).)))((((((…))).)))…
RS 3 seq CAACAACCCCACGGGAGUCCGGGCAUCGGGCUGAGAGGGGGGCUGACGCCGCCCCCGACCGUCAAACCUGAUCCGGGUAAUGCCGGCGCAGGGAGGACUGCUCCAUGGUUA
RS 3 dot ……(((…)))((((((…..))))))….(((((((….))).))))((.(((.((.(((((…)))))..)).)))))((.((((…..)))).))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table