Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA112915 Similarity: 0.965 Similarity: 0.965 Similarity: 0.964
UTR: 5HSAA112915
Gene: TPM3_2
MFE: -35.364
ENS: 0.821
Length: 123.
Predicted Ligands:
guanidine - 6/20
TPP - 5/20
glycine - 4/20
 RS: URS0000AB444A_406425
MFE: -42.787
Ligand: guanidine
Species: Burkholderia cenocepacia MC0-3 Guanidine-I riboswitch
 RS: URS0000D8BDA8_1913576
MFE: -38.549
Ligand: methionine
Species: Arthrobacter sp. UCD-GKA S-adenosyl methionine (SAM) riboswitch,
 RS: URS00004AA15C_216591
MFE: -47.287
Ligand: guanidine
Species: Burkholderia cenocepacia J2315 Guanidine-I riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA112915 URS0000AB444A_406425 URS0000D8BDA8_1913576 URS00004AA15C_216591
Length 123. 122. 122. 122.
Similarity - 0.965 0.965 0.964
Ensemble Norm 0.821 - - -
MFE -35.364 -42.787 -38.549 -47.287
Ligands - guanidine methionine guanidine
Gene TPM3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.001 3. 2.001
Length SE - 1. 1. 1.
Lev Distance - 45. 45. 46.
UBS 10. 10. 11. 10.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 1.
ILR 1. 1. 0. 1.
H 4. 3. 4. 3.
BL 5. 6. 5. 6.
BR 4. 4. 5. 4.
UN 0.163 0.139 0.180 0.139

Sequences

Field Description
UTR seq + 25 uuucagggcguagcaggcggaaguaagggugagaggaggcugcaacgccgagcggaggaggcaggaaccggagcgcgagcaguagcugggugggcaccATGGCTGGGATCACCACCATCGAGG
UTR dot + 25 ……(((((.((((.(……………….).)))).)))))..((…….))…….((.((.((..(((…)))..)).)).))((((.(((…..)))))))…..
RS 1 seq UCUUAGGGUUGCUAGGGUUCCGGUUCAUCGAACGUCUGGUCCGAGAGCAGCCCGGCACGGGUUCACCCGAUCGCGAGACCGGAUGCGCACGUGCUACACGGCGGGACAAAAGCCCGGGAGAU
RS 1 dot …..((((((((.(((..((((…………)))))))…))))))))((((((.((.((.(((.((….)).))).)).)).))))))……((((.(….)))))……
RS 2 seq CUUCACGAGAUGCGCGCCAGAUAUGGGCUCCGACCCGGCGACACACCAACCCCAUGCUUCACGGGUGGUUCGGAUGACGAAGCGGUCCUUGGCGGCAACCGCCCCGGGGACAAGAGCACACG
RS 2 dot ……..(.((.(((((……(((……))))))).).)).)…(((.((…)).)))((.((((…..)))).))((((((((.(((….)))))))))))………..
RS 3 seq UCUUAGGGGUGCUAGGGUUCCGGUUCAUCGAGCGUCUGGUCCGAGAGCAGCCCGGCGCGGGUUCAUCCGUUCGCGAGACCGGAUGCGCACGCGCUACACGGCGGGACAAAAGCCCGGGAGAU
RS 3 dot …..(((.((((.(((..((((…………)))))))…)))).)))((((((.((.((((((.((….)).)))))).)).))))))……((((.(….)))))……

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table