Detected as a riboswitch by 19 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113038 Similarity: 0.975 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA113038
Gene: TPRG1L
MFE: -48.812
ENS: 0.944
Length: 106.
Predicted Ligands:
fluoride - 6/20
TPP - 6/20
SAM - 3/20
 RS: URS0000BF7322_269482
MFE: -48.558
Ligand: fluoride
Species: Burkholderia vietnamiensis G4 Fluoride riboswitch
 RS: URS000230B8E7_60552
MFE: -48.558
Ligand: fluoride
Species: Burkholderia vietnamiensis Fluoride
 RS: URS000231386C_1822245
MFE: -29.336
Ligand: cobalamin
Species: Oleiphilus sp. HI0069 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113038 URS0000BF7322_269482 URS000230B8E7_60552 URS000231386C_1822245
Length 106. 106. 106. 106.
Similarity - 0.975 0.975 0.975
Ensemble Norm 0.944 - - -
MFE -48.812 -48.558 -48.558 -29.336
Ligands - fluoride fluoride cobalamin
Gene TPRG1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 14.001 14.001 13.013
Length SE - 0. 0. 0.
Lev Distance - 27. 27. 28.
UBS 9. 10. 10. 8.
BS 0. 0. 0. 0.
ILL 1. 1. 1. 2.
ILR 2. 0. 0. 1.
H 3. 3. 3. 3.
BL 5. 5. 5. 2.
BR 3. 6. 6. 2.
UN 0.066 0.104 0.104 0.179

Sequences

Field Description
UTR seq + 25 gggcgcggccgggugguggcgguggcugcggcgacggcggucgcgucggcgucagggucggggucgguaaggggugcggcaATGCTGCAACTGCGGGACTCGGTGG
UTR dot + 25 ..(((((((((.((.((.((((…)))).)).))..)))))))))((((……))))(((((.((…((.((((((…)))))).))))..)))))…..
RS 1 seq GCCGGCUGCGGAGAUGGCAUGCCUCCCUGCGGUCGAGCACGGCGCGUUGCGCGCGCGAGUCGGCCCUCAACCGCCGGUGAGCCCGGCUGAUGAUGCCUGCGUGUUC
RS 1 dot (((((((((((.((.((….)))).))))))))).))…((((((…))))))..((.(((..(((.(.(((((…..))))).).))).))).))……
RS 2 seq GGCGGCUGCGGAGAUGGCAUGCCUCCCUGCGGUCGACCACGGCGCGUUGCGCGCGCGAGUCGGCCCUCAACCGCCGGUGAGCCCGGCUGAUGAUGCCUGCGUGUUC
RS 2 dot (((((((((((.((.((….)))).))))))))).))…((((((…))))))..((.(((..(((.(.(((((…..))))).).))).))).))……
RS 3 seq GACUAGCUCUCGCCACUGUGUAAUUAAUACAUGGGAAGGCGCUAGUUCUACUGACAGUGAUCAGAUGCUCAUAAGCCCGGAGACCGGCCUGAGAACUUAAUUUAAG
RS 3 dot ((((((((((..(((.(((((…..))))))))..))).)))))))…((((……))))…((((…(.((((…))))).))))………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table