Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113039 Similarity: 0.986 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA113039
Gene: TPRG1L_0
MFE: -27.481
ENS: 0.989
Length: 74.
Predicted Ligands:
fluoride - 9/20
cobalamin - 3/20
homocysteine - 3/20
 RS: URS0000C7704B_1032480
MFE: -24.296
Ligand: fluoride
Species: Microlunatus phosphovorus NM-1 Fluoride riboswitch
 RS: URS0000AB86D1_710696
MFE: -27.445
Ligand: cobalamin
Species: Intrasporangium calvum DSM 43043 Cobalamin riboswitch
 RS: URS0000ABCBAB_266264
MFE: -23.599
Ligand: homocysteine
Species: Cupriavidus metallidurans CH34 S-adenosyl-L-homocysteine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113039 URS0000C7704B_1032480 URS0000AB86D1_710696 URS0000ABCBAB_266264
Length 74. 73. 75. 74.
Similarity - 0.986 0.983 0.982
Ensemble Norm 0.989 - - -
MFE -27.481 -24.296 -27.445 -23.599
Ligands - fluoride cobalamin homocysteine
Gene TPRG1L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 1. 10.
Length SE - 1. 1. 0.
Lev Distance - 17. 22. 19.
UBS 9. 8. 9. 7.
BS 0. 0. 0. 0.
ILL 2. 1. 2. 2.
ILR 2. 2. 2. 1.
H 1. 1. 1. 1.
BL 5. 5. 5. 3.
BR 6. 5. 5. 5.
UN 0.041 0.110 0.027 0.041

Sequences

Field Description
UTR seq + 25 gacggcggucgcgucggcgucagggucggggucgguaaggggugcggcaATGCTGCAACTGCGGGACTCGGTGG
UTR dot + 25 ..((.(((((.(((..(((.((..((((.(.((……)).).))))..)).)))….))).))).)).)).
RS 1 seq GGUAGCCGUGGCGAUGGUGUCCGCCUGAGGAUCGUCCUCGAACCGCCGGCCGGCUGAUGACCCCUGCGACGAA
RS 1 dot ……(((.(((..((((((.(((.(.((.(((….))).)).).))).)))…..)))..))).)))..
RS 2 seq ACCAGGAACCCGGUGCGAGCCCGGGACGGUCCCGCCACUGUGAGCGCGCCCUCCGGGGCCGUGAGUCAGGAACUG
RS 2 dot ..(((…((.((.(((.((((.(((.(((..(((((…)).))).))).))).)))))))…)).))..)))
RS 3 seq CACUCCGAGGAGCGUUGCAACGGAUGGCCUCGCCUUCCGCCAGGCUCGGAAUGUUUCAACGGCGCUCGCAGUUC
RS 3 dot .(((.((((..((((((.((((…(((((.((…..)).)))))…..)))).))))).).)))).)))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table