Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113232 Similarity: 0.984 Similarity: 0.983 Similarity: 0.982
UTR: 5HSAA113232
Gene: TRAF5
MFE: -12.554
ENS: 0.946
Length: 85.
Predicted Ligands:
cyclic-di-GMP - 11/20
zmp-ztp - 3/20
GMP - 2/20
 RS: URS0000ABB5BE_709986
MFE: -22.377
Ligand: cyclic-di-GMP
Species: Deinococcus maricopensis DSM 21211 Cyclic di-GMP-II riboswitch
 RS: URS0000C3D27D_1619089
MFE: -12.653
Ligand: cyclic-di-GMP
Species: candidate division WS6 bacterium GW2011_GWC1_33_20 Cyclic di-GMP-II riboswitch
 RS: URS0000C52732_1126833
MFE: -17.920
Ligand: cyclic-di-GMP
Species: Paenibacillus beijingensis Cyclic di-GMP-II riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113232 URS0000ABB5BE_709986 URS0000C3D27D_1619089 URS0000C52732_1126833
Length 85. 85. 84. 84.
Similarity - 0.984 0.983 0.982
Ensemble Norm 0.946 - - -
MFE -12.554 -22.377 -12.653 -17.920
Ligands - cyclic-di-GMP cyclic-di-GMP cyclic-di-GMP
Gene TRAF5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 4.001 6.009 4.005
Length SE - 0. 1. 1.
Lev Distance - 20. 20. 22.
UBS 5. 4. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 0.
ILR 2. 1. 0. 1.
H 3. 3. 3. 3.
BL 0. 1. 1. 1.
BR 0. 0. 1. 0.
UN 0.188 0.224 0.095 0.262

Sequences

Field Description
UTR seq + 25 agacgcacgugagggaaaucagaugacuggacuuguagauacuaacgguucugaagcggaATGGCTTATTCAGAAGAGCATAAAG
UTR dot + 25 …..((..(((……)))..))((((…………….))))((((((((……)))…)))))………..
RS 1 seq AACUAGUUCAGGAGCAAUGAAACAUCUGGCGUUACACGGGCGCCUGCCAGAUGCGGAGCGAGUGGCGCGACCGACAGAACCGAGG
RS 1 dot ……((((…….)))).(((((((((………….)))))))))(((.(((…..)))..)))…………
RS 2 seq UCAUAUAUCAAAUGCUAUGAUGUACUCUUUCUAUUUGGUUGCCUUAAGAGUAUGGAGCAAAUGGCAAAACCGCUUGAUAAUAAU
RS 2 dot …(((((((…….)))))))(((((…………….)))))(((.((((….((…..)))))).)))…..
RS 3 seq CUAUAAUUUGGGCGCGGAGAAACCGGAUCUGUAUAUGGGCACUUGGAUCCGGCGGAGCGACUAGUGCAACCGACCACUUUCAAC
RS 3 dot ……((((….))))….(((((((((…………)))))))))(((.(((…..)))..)))…………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table