Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113314 Similarity: 0.984 Similarity: 0.984 Similarity: 0.981
UTR: 5HSAA113314
Gene: TRAPPC2L
MFE: -30.925
ENS: 0.975
Length: 78.
Predicted Ligands:
zmp-ztp - 8/20
fluoride - 6/20
cobalamin - 4/20
 RS: URS000232E97F_393303
MFE: -36.880
Ligand: zmp-ztp
Species: Nocardioides sp. PD653 ZMP/ZTP riboswitch
 RS: URS0000D8A5FB_512402
MFE: -26.766
Ligand: fluoride
Species: Mycobacterium sp. NCTC 13432 Fluoride riboswitch
 RS: URS000232DEB4_12908
MFE: -15.528
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113314 URS000232E97F_393303 URS0000D8A5FB_512402 URS000232DEB4_12908
Length 78. 78. 78. 79.
Similarity - 0.984 0.984 0.981
Ensemble Norm 0.975 - - -
MFE -30.925 -36.880 -26.766 -15.528
Ligands - zmp-ztp fluoride cobalamin
Gene TRAPPC2L - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 3.003 0.002
Length SE - 0. 0. 1.
Lev Distance - 20. 21. 25.
UBS 5. 6. 6. 5.
BS 0. 0. 0. 0.
ILL 1. 0. 1. 1.
ILR 2. 1. 2. 2.
H 3. 3. 3. 3.
BL 1. 2. 2. 1.
BR 0. 1. 1. 0.
UN 0.128 0.141 0.179 0.089

Sequences

Field Description
UTR seq + 25 gcgugaccagcggcgggucacgugacgcggugccuggcgccgagccucccaagATGAGAAGATCTCCGCAATGGGGAA
UTR dot + 25 ((((((((…….))))))))….((((((…))))))….(((((.(..((((…))))..)..)))))..
RS 1 seq AACUGCUCGCGCGUCUUGGCGUAGUCGAGGGCCACCUCGUAGGCGGCGCGCGCGAUGCCGAUCGCCUGGGCGCCGACG
RS 1 dot ….(((.((((……)))))))(((((….)))))….((((((.((((((….)))))..).))))))…
RS 2 seq CUGGGGACGCGCGAUGGAUCUCCGCCGGGGCACUUGAGUGCCCAAACCGCCGUUCUGGCUGAUGGUUCCUGCCCGGAC
RS 2 dot ..(((((..(…..)..)))))….((((((….))))))……..((((.(((.((….))..))).))))
RS 3 seq CUGCUGAAUCUUAGUGGGAAAUCAGUGUGAAAUUCAUUGGCUGUACCUGCAACCGUAAAGUCGGAGUGCCACUCAGUAA
RS 3 dot (((((((…)))))))…..(((((…….)))))((((…..(((.(((……)))..)))….))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table