Detected as a riboswitch by 13 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113791 Similarity: 0.972 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA113791
Gene: TRIP12
MFE: -40.455
ENS: 0.844
Length: 134.
Predicted Ligands:
cobalamin - 12/20
FMN - 4/20
SAM - 3/20
 RS: URS0000DAAAAF_546364
MFE: -53.988
Ligand: SAM
Species: Amycolatopsis australiensis SAM riboswitch (S box leader)
 RS: URS0000ABD013_713604
MFE: -54.588
Ligand: SAM
Species: Amycolatopsis mediterranei S699 SAM riboswitch (S box leader)
 RS: URS0000AB6BD5_591158
MFE: -53.988
Ligand: SAM
Species: Streptomyces sp. AA4 SAM riboswitch (S box leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113791 URS0000DAAAAF_546364 URS0000ABD013_713604 URS0000AB6BD5_591158
Length 134. 134. 134. 134.
Similarity - 0.972 0.972 0.972
Ensemble Norm 0.844 - - -
MFE -40.455 -53.988 -54.588 -53.988
Ligands - SAM SAM SAM
Gene TRIP12 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7. 7.
Length SE - 0. 0. 0.
Lev Distance - 34. 34. 34.
UBS 12. 13. 13. 13.
BS 0. 0. 0. 0.
ILL 4. 2. 2. 2.
ILR 5. 4. 4. 4.
H 2. 2. 2. 2.
BL 6. 6. 6. 6.
BR 4. 5. 5. 5.
UN 0.097 0.090 0.090 0.090

Sequences

Field Description
UTR seq + 25 gcuaguggaaguuacugccgcgccaccgaguccggaccggagacuuuggggccuaacuagugaaugguagugucuagaaaggguaugucccuucaagagagaggugccaATGTCCAACCGGCCTAATAACAATC
UTR dot + 25 (((.((((..((…….)).))))..)))..((.((((.(((.((((.((((..((..((((.((..((((((…..))))))..)).))))..))..)))).)))).)))…))))))………..
RS 1 seq CGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGACGAAGCCCCGGCAACCGGCGUACAGCCCGUCAUCCCGCGAUCGCGGGGUAGCUGACGACCACGGUGCCAAUUCCGGCCCGCUUCGGCGGGGCAGAUGAGGA
RS 1 dot (.(((..((…..))..))).)…(.((((.((((((.(((((.((((((((.((((…..(((((((….))))))).))))))).))..))))))……))…)))))).)))).)………
RS 2 seq CGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGACGAAGCCCCGGCAACCGGCGUACAGCCUGUCAUCCCGCGAUCGCGGGAUAGCUGACGACCACGGUGCCAAUUCCGGCCCGCUUCGGCGGGGCAGAUGAGGA
RS 2 dot (.(((..((…..))..))).)…(.((((.((((((.(((((.((((((((.((((…..(((((((….))))))).))))))).))..))))))……))…)))))).)))).)………
RS 3 seq CGCUCAUCCAGAGGGGCAGAGGGAACGGCCCGACGAAGCCCCGGCAACCGGCGUGCAGCCUGUCAUCCCGCGAUCGCGGGGUAGCUGACGACCACGGUGCCAAUUCCGGCCCGCUUCGGCGGGGCAGAUGAGGA
RS 3 dot (.(((..((…..))..))).)…(.((((.((((((.(((((.((((((((.((((…..(((((((….))))))).))))))).))..))))))……))…)))))).)))).)………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table