Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113890 Similarity: 0.974 Similarity: 0.974 Similarity: 0.973
UTR: 5HSAA113890
Gene: TRMT5
MFE: -36.722
ENS: 0.941
Length: 116.
Predicted Ligands:
TPP - 18/20
methionine - 2/20

 RS: URS0000ABB1CA_431241
MFE: -33.481
Ligand: TPP
Species: Trichoderma reesei QM6a TPP riboswitch (THI element)
 RS: URS0000BF2EBF_1401063
MFE: -50.208
Ligand: methionine
Species: Pseudoglutamicibacter albus DNF00011 S-adenosyl methionine (SAM) riboswitch,
 RS: URS0000AB8BA5_999541
MFE: -43.291
Ligand: TPP
Species: Burkholderia gladioli BSR3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113890 URS0000ABB1CA_431241 URS0000BF2EBF_1401063 URS0000AB8BA5_999541
Length 116. 116. 116. 117.
Similarity - 0.974 0.974 0.973
Ensemble Norm 0.941 - - -
MFE -36.722 -33.481 -50.208 -43.291
Ligands - TPP methionine TPP
Gene TRMT5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.005 3. 7.001
Length SE - 0. 0. 1.
Lev Distance - 32. 34. 31.
UBS 11. 10. 11. 9.
BS 0. 0. 0. 0.
ILL 4. 2. 3. 4.
ILR 3. 3. 2. 2.
H 2. 2. 2. 2.
BL 4. 4. 4. 3.
BR 3. 4. 4. 4.
UN 0.034 0.103 0.017 0.068

Sequences

Field Description
UTR seq + 25 auccacccgcgacccacauccgaucgguaccggagcgggaggugaggggucggcucgcggauccagcugcagagcgacguggggaauuggaATGGTGCTTTGGATCTTATGGAGGC
UTR dot + 25 ..((.(((((..(((.(.((((……..))))).)))..))).))))..(.(((..(((((((……((((..(((………..)))..)))))))))))….))).)
RS 1 seq AGCUUUCAGGCUGGGUGUUGGACACGAGACGCAGCAUGAUAGAGCAGGUUGAUCUGAGAAAUACCGGCGAACUUGAUCUGGAUAAUACCAGCGAAAGGAUCUGCUUCUUGGGCUUC
RS 1 dot .(((((((.((((.((.(((….))).)).)))).)))..))))…….(((((((……(((((.(((…((((……))))…)))..)).))))))))))….
RS 2 seq GGUCAUGAGUGCCAGUGCAAAACCCCGGUUUGCUGGCCGGCAACCCUCCGUCCGCGGCGGGGUGCCCCGGGUGAGGACCUGGUCACACGGGAAUGCCGCUGUGGCAAGCGCGGGCU
RS 2 dot (((..((.(.((((((…((((….)))))))))))..)))))(((((((((((((((.((..((((.((((……..)))).)))).)).)))))))))…))).)))..
RS 3 seq UUGCUAACGCGGGGGUCCUGCGUUGCGCCAUUCGGAAUGCGGCGCAUCGCGGGUGAGAAAUACCCUUUGAACCUGAUCUGGAUAAUGCCAGCGCAGGGAAGCGUACGGGCCUCGCCA
RS 3 dot …….(((((..((.(((((((.((…..)).))))))).)).)))))((((((…(((.((((…((((..((((……))))..)))))))).)))…..)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table