Detected as a riboswitch by 15 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113898 Similarity: 0.987 Similarity: 0.986 Similarity: 0.986
UTR: 5HSAA113898
Gene: TRMT61B
MFE: -22.351
ENS: 0.912
Length: 57.
Predicted Ligands:
unknown - 14/20
cobalamin - 3/20
glutamine - 3/20
 RS: URS0000E5FB36_465721
MFE: -27.757
Ligand: unknown
Species: Steroidobacter denitrificans nhaA-I RNA
 RS: URS0000E6033C_1735674
MFE: -24.307
Ligand: unknown
Species: Sphingomonas sp. Leaf9 nhaA-I RNA
 RS: URS0000D6830C_169430
MFE: -22.342
Ligand: unknown
Species: Paraburkholderia hospita nhaA-I
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113898 URS0000E5FB36_465721 URS0000E6033C_1735674 URS0000D6830C_169430
Length 57. 56. 58. 57.
Similarity - 0.987 0.986 0.986
Ensemble Norm 0.912 - - -
MFE -22.351 -27.757 -24.307 -22.342
Ligands - unknown unknown unknown
Gene TRMT61B - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.005 11.001 5.008
Length SE - 1. 1. 0.
Lev Distance - 15. 14. 17.
UBS 3. 5. 5. 4.
BS 0. 0. 0. 0.
ILL 1. 1. 0. 2.
ILR 0. 1. 1. 1.
H 2. 2. 2. 1.
BL 0. 1. 2. 1.
BR 1. 2. 2. 1.
UN 0.158 0.089 0.190 0.070

Sequences

Field Description
UTR seq + 25 acucgucugcgacggcgccuucgcgaaacacuATGCTAATGGCATGGTGCCGCGGTC
UTR dot + 25 ..(((((…)))))…..(((((…(((((((((…))))))))).)))))..
RS 1 seq GGGUGUUGCGCCGCAGCGGCGGCAAGACAGGUUUAAUGCUGGUCGGGCCGCCAGCA
RS 1 dot .((((…))))…((((((((..(((.(((…..))).)))..)))))).)).
RS 2 seq GGGUGUUCGGCGCGGCAAGGCGGCGGGCAGGGUAUUCGCGCUGGUCGGGCCGCCAGUG
RS 2 dot ..((((…))))…..((((((((.(((.((….)).))).))..))))))….
RS 3 seq GGGUGUUAGCUGCAUGCCACAGCGGCGCAGGUCAACUGUGCUGGUCGGGCCGCCACG
RS 3 dot .((((……….(((..(.((((((((…..)))))))).)..)))))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table