Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA113975 Similarity: 0.984 Similarity: 0.981 Similarity: 0.978
UTR: 5HSAA113975
Gene: TRPC3
MFE: -36.479
ENS: 0.645
Length: 99.
Predicted Ligands:
guanidine - 4/20
TPP - 4/20
SAM - 4/20
RS: URS0000C39470_1158610
MFE: -25.345
Ligand: guanidine
Species: Enterococcus phoeniculicola ATCC BAA-412 Guanidine-I riboswitch
RS: URS0000AB223C_1300150
MFE: -22.385
Ligand: TPP
Species: Enterococcus mundtii QU 25 TPP riboswitch (THI element)
RS: URS0000C76789_97137
MFE: -17.345
Ligand: purine
Species: Lactobacillus sp. ASF360 Purine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA113975 URS0000C39470_1158610 URS0000AB223C_1300150 URS0000C76789_97137
Length 99. 98. 98. 98.
Similarity - 0.984 0.981 0.978
Ensemble Norm 0.645 - - -
MFE -36.479 -25.345 -22.385 -17.345
Ligands - guanidine TPP purine
Gene TRPC3 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3. 9. 9.
Length SE - 1. 1. 1.
Lev Distance - 19. 20. 23.
UBS 11. 10. 9. 9.
BS 0. 0. 0. 0.
ILL 2. 2. 2. 2.
ILR 3. 2. 3. 3.
H 1. 1. 1. 1.
BL 6. 7. 5. 5.
BR 6. 6. 4. 4.
UN 0.081 0.061 0.082 0.061

Sequences

Field Description
UTR seq + 25 gggaagacugcacugccgcgaaggcggaggaggccggcagccggcacccccacacucggaccgcagccggcgcgATGTCCACCAAGGTCAGGAAGTGCA
UTR dot + 25 ……..((((((.((((…((.(((.(.(((((((.(.(((…((……..)).)))).)))))).)..).))).))…))..)).))))))
RS 1 seq GCAAAAGUUUUCUAGGGUUCCGUAGCUGCUUGCUAGACUGGUCCAAGGGAAAACGCACAUGGAUCUGUGUAACACGGAGGGACAAAAGCCCGGGAGAU
RS 1 dot ……(((((((.(((((..((..((.(.((.((.((.((((((.(……….).)))))).)).)).)).).))..))…))))))))))))
RS 2 seq UUUUGUUUGCAGGGGGACGUUAUCGCGUUGAGAAGGUAAAACCUGACCCUUUGAACCUGUUGGUUGAUACCAGCGUAGGGAGCAAAUGUCCUUUUUGU
RS 2 dot ……..(((((((((((((..(.(.(((.(..((((.((((.(((………..)))))))..))))..).))).).)..)))))))))).)))
RS 3 seq ACAUGAAAGCAACUUAAAACUUAUAUAUCGUCGAAAUAAGGUCGACAGUUUCUACCCUGAACCAUAAAUUCAGGACUAUAAGUGGUUUGAGAAUGCUU
RS 3 dot ……(((((.(((((((((((((..((.(.(((.((.(((…(((……..))).))).))..)))).)).)))))))..))))))..)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table