Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114063 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA114063
Gene: TRPM6
MFE: -16.220
ENS: 0.935
Length: 97.
Predicted Ligands:
guanidine - 12/20
TPP - 6/20
Ni/Co - 2/20
 RS: URS00000D4AAA_28173
MFE: -18.952
Ligand: TPP
Species: Vibrio nigripulchritudo TPP riboswitch (THI element)
 RS: URS0000AE1366_1918946
MFE: -28.722
Ligand: guanidine
Species: Vibrio palustris Guanidine-I riboswitch
 RS: URS0000C453A8_1581149
MFE: -20.263
Ligand: TPP
Species: Grimontia sp. AD028 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114063 URS00000D4AAA_28173 URS0000AE1366_1918946 URS0000C453A8_1581149
Length 97. 97. 97. 98.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.935 - - -
MFE -16.220 -18.952 -28.722 -20.263
Ligands - TPP guanidine TPP
Gene TRPM6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 13. 10. 15.
Length SE - 0. 0. 1.
Lev Distance - 20. 23. 21.
UBS 8. 7. 8. 7.
BS 0. 0. 0. 0.
ILL 0. 1. 1. 2.
ILR 0. 3. 2. 1.
H 3. 3. 3. 3.
BL 4. 3. 2. 1.
BR 2. 1. 1. 2.
UN 0.216 0.196 0.206 0.214

Sequences

Field Description
UTR seq + 25 aucuaacgaggaucuagaauagcuaggauuuaugaaauaccggcuuucaaguucucuggucuccacccaaagATGATTATCCTATCTAAGTCCCAGA
UTR dot + 25 …….(((((.((.(((.((((.((((((…)))).))))))))).))))))).(((….)))…(((((…….)))))……….
RS 1 seq GAAUAAUAGUCGGGGAGCCUUAGGCUGAGAUCGCAUAGCGAGACCCGUUGAACCUGAUUCAGUUAACACUGGCGUAGGGAACUAUGAAUCUUACUGU
RS 1 dot …….(((((((.(((.((..((((.(….).))))..))…)))…)))))))((((….)))).(((((….)))))………..
RS 2 seq UAAAAAGACAUCUAGGGUUCCGGCUGCAUCGCAGUGACUGGUCCGAGAGUUGUCAACCUCUUAUGAGGUCACACGGCGGGACAAAAGCCCGGGAGAA
RS 2 dot ……(((((((.(((..((((((((…))))…))))))).)))..)))).(((((….)))))…….((((.(….)))))……
RS 3 seq GAGAAAUAGUCGGGGAGCCAAUUGGCUGAGAACGCAUCGCGUGACCCGUUGAACCUGAGGCAGUUAAUACUGACGUAGGGAACUAUGUUGAAGUUGGG
RS 3 dot ………(((((….((((.(((…..((((…))))).)).))))..)))))..((((….))))((((((….))))))……….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table