Detected as a riboswitch by 6 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114124 Similarity: 0.981 Similarity: 0.980 Similarity: 0.980
UTR: 5HSAA114124
Gene: TRPV6
MFE: -19.966
ENS: 0.812
Length: 98.
Predicted Ligands:
TPP - 8/20
glycine - 5/20
purine - 3/20
 RS: URS0000C16C0C_1423739
MFE: -25.999
Ligand: TPP
Species: Lactobacillus diolivorans DSM 14421 TPP riboswitch (THI element)
 RS: URS0000AB398E_1069534
MFE: -23.627
Ligand: purine
Species: Lactobacillus ruminis ATCC 27782 Purine riboswitch
 RS: URS0000C5A762_1604020
MFE: -34.045
Ligand: TPP
Species: Candidatus Synechococcus spongiarum SP3 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114124 URS0000C16C0C_1423739 URS0000AB398E_1069534 URS0000C5A762_1604020
Length 98. 99. 100. 99.
Similarity - 0.981 0.980 0.980
Ensemble Norm 0.812 - - -
MFE -19.966 -25.999 -23.627 -34.045
Ligands - TPP purine TPP
Gene TRPV6 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.003 10. 1.
Length SE - 1. 4. 1.
Lev Distance - 22. 18. 26.
UBS 9. 8. 7. 9.
BS 0. 0. 0. 0.
ILL 4. 2. 2. 4.
ILR 1. 1. 1. 2.
H 1. 1. 1. 1.
BL 4. 5. 3. 4.
BR 4. 5. 3. 4.
UN 0.061 0.010 0.060 0.040

Sequences

Field Description
UTR seq + 25 ccugaacaaguugcucaaguaugaggauugcaaggugcaccagagagaagccauauaacccaccucucuguaaACGGGACCTCTACAGGGAGACGGTG
UTR dot + 25 …..((..(((.(((..(((.((((.((.(…((….(((((((…………….)))))))…))).))))))))).))).))).)).
RS 1 seq UAUGAUCACUAGGGGUGCUGUAUGCUGAGAUGGCGGAUUGCCAAUCCCUUUGAACCUGAUUUGGUUAGAACCAACGUAGGGUAUUGCAUCCGUACAUAA
RS 1 dot ((((…..((.((((((.((((.(((.(.(((……(((((…………….)))))…..))).).))).)))).)))))).)))))).
RS 2 seq UUAUCCUAUGCUAGUGUUACUUGUAUAAAUGCCGUAAUAUGGUCGGCAAGUUUCUACCCAAGGCCGUAAAUCUUGGACUAUGAGUAAGAAUAGCUAGGUU
RS 2 dot ….((((.((((.(.(((((((((…..((((…(((((((……………..)))))))…..))).)))))))))).).))))))))..
RS 3 seq GAUCAUCACUAGGGGUGCCGCCAUCCUUUGGCGGCUGAGAUCACACCCUCCGAACCUGACGCGGUUGGCACCGCCGUAGGGAAGUGAGCCUGUCGUGAU
RS 3 dot ….(((((.(.((((..(((..((((.((((((.((……..((..(((………)))..)))))))))).))))..))).)))).).)))))

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table