Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114379 Similarity: 0.969 Similarity: 0.969 Similarity: 0.968
UTR: 5HSAA114379
Gene: TSPAN19
MFE: -18.255
ENS: 0.986
Length: 126.
Predicted Ligands:
SAM - 10/20
cobalamin - 5/20
FMN - 2/20
 RS: URS0000D8ADD6_1933778
MFE: -47.743
Ligand: SAM
Species: Saccharothrix sp. ALI-22-I SAM riboswitch (S box leader)
 RS: URS0000C10336_1629721
MFE: -33.514
Ligand: SAM
Species: Flavobacteriales bacterium BRH_c54 SAM riboswitch (S box leader)
 RS: URS0000D6A33B_12908
MFE: -48.167
Ligand: GMP
Species: unclassified sequences c-di-GMP-II-GAG riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114379 URS0000D8ADD6_1933778 URS0000C10336_1629721 URS0000D6A33B_12908
Length 126. 127. 126. 125.
Similarity - 0.969 0.969 0.968
Ensemble Norm 0.986 - - -
MFE -18.255 -47.743 -33.514 -48.167
Ligands - SAM SAM GMP
Gene TSPAN19 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.014 16.022
Length SE - 1. 0. 1.
Lev Distance - 39. 39. 37.
UBS 6. 7. 8. 9.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 3.
ILR 2. 2. 3. 3.
H 3. 3. 3. 3.
BL 1. 2. 2. 2.
BR 1. 1. 1. 2.
UN 0.270 0.244 0.151 0.120

Sequences

Field Description
UTR seq + 25 aaacaaucucgauucuaaauugaaacgaacgcagcauuucagggacuggaugaggagcuuacgguuuuuuacagaaucaucaauaucuuggaagaaaaagaATGTTAAGAAATAACAAAACAATAA
UTR dot + 25 ……..(((.(((……))).)))……..((((((((….(((((((((((…))))))……..)))))….))))))))………(((((…..)))))………
RS 1 seq CGCUCAUCCAGAGGGGCAGAGGGAUCGGCCCGAAGAAGCCCCGGCAACCCGUCGUUCAGCGCGCGUCCACCGUGCGCCGGCGAUCACGGUGCCAAUUCCGACCCGCGACGCGUGGGAAAGAUGAGGA
RS 1 dot …………(((((…(((…..)))……)))))(((.(((.((((((..(((((((…..))))))).))))))…))))))……..((((((…))))))………..
RS 2 seq UGUUUAUCAAGAAAGGUGGAGGGAAUAGGCCCUGUGAAACCUUGGCAACCAACUAUAAGUCUUGCAUAAGCGAGAUUGGAAAAUCGGUGCUAAAUCCUAUCCCGAUAAAUCGGGAAAAGAUAAGUA
RS 2 dot …………..((((.((((……)))).)…)))(((((.(((…….((((((((….))))))))……..))))))))(((…((((((….))))))…)))…..
RS 3 seq UGACACCACGGACGCAUCGAUCCUCGGGUAGAGGUUCCAGACGGUCGCCCAUCGGGUUGGGGCUGUUCCAGCGCCAACCGCCGGUGACCCGGGGGGAGCGAAUGGCGAGACCGGCCGUGAGAUGA
RS 3 dot ..((.((..(((((…)).)))..))))….(((((….(((((((…..((((((.((((…)))).))))))…)))))))…..)))))..(((((…….)))))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table