Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114421 Similarity: 0.984 Similarity: 0.983 Similarity: 0.983
UTR: 5HSAA114421
Gene: TSPAN5
MFE: -11.862
ENS: 0.973
Length: 81.
Predicted Ligands:
cobalamin - 12/20
SAM - 3/20
zmp-ztp - 2/20
 RS: URS0000C4FEA2_1007676
MFE: -16.949
Ligand: SAM
Species: Lactobacillus sp. EMML 3041 SMK box translational riboswitch (SAM-III)
 RS: URS0002320F9E_12908
MFE: -17.979
Ligand: cobalamin
Species: unclassified sequences AdoCbl variant RNA
 RS: URS0000C736A9_1423744
MFE: -16.866
Ligand: SAM
Species: Lactobacillus floricola DSM 23037 = JCM 16512 SMK box translational riboswitch (SAM-III)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114421 URS0000C4FEA2_1007676 URS0002320F9E_12908 URS0000C736A9_1423744
Length 81. 82. 81. 81.
Similarity - 0.984 0.983 0.983
Ensemble Norm 0.973 - - -
MFE -11.862 -16.949 -17.979 -16.866
Ligands - SAM cobalamin SAM
Gene TSPAN5 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 7.022 13.001
Length SE - 1. 0. 0.
Lev Distance - 19. 21. 19.
UBS 5. 7. 5. 5.
BS 0. 0. 0. 0.
ILL 2. 3. 1. 3.
ILR 2. 2. 0. 4.
H 1. 1. 2. 1.
BL 2. 2. 2. 0.
BR 2. 2. 1. 0.
UN 0.160 0.146 0.309 0.136

Sequences

Field Description
UTR seq + 25 auugcuaauaauaacaccagugggggaaacuugaagaaagagguauuugucaccaaATGTCCGGGAAGCACTACAAGGGTC
UTR dot + 25 ..((((…….(((…((((.(((.((((……..)))).))).))))….)))……))))………..
RS 1 seq UCUAGUAAAAGGUUCCUGAUGGGAUCCUUUUUUGUUUAACAAAGGAGAGGCCCUGUAACCGAAAGGUGGAAAGUUUAUUAUG
RS 1 dot ((((.(….(((…((..(((.(((((((((((…))))))))).)))))..)))))….).))))…………
RS 2 seq AUACUGAAAUGCAUGGUGGGGAAUCAAUGCGAAAUUCGUUGGCUGUACCUGCAACCGUAAAGUCGGAGCGCCACCCAGUAG
RS 2 dot ………((((.((((.((..((((((…….)))))))).)))))))).(((……)))……………
RS 3 seq GAUUCUUACUUGUGUUCCCGAUAGGAUCUAGUUAAAUACUAGAUAUGCCUUGUAACCGAAUCGAAGGGGGAAAUAAAAAUG
RS 3 dot ..((((..(((..((((…((((((((((((…..)))))))….)))))….))))..)))..))))………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table