Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114462 Similarity: 0.981 Similarity: 0.981 Similarity: 0.980
UTR: 5HSAA114462
Gene: TSPY1
MFE: -29.047
ENS: 0.852
Length: 95.
Predicted Ligands:
TPP - 8/20
purine - 4/20
SAM - 3/20
 RS: URS000231F385_266940
MFE: -32.233
Ligand: SAM
Species: Kineococcus radiotolerans SRS30216 SAM riboswitch (S box leader)
 RS: URS0000C78CDD_1139996
MFE: -12.928
Ligand: purine
Species: Enterococcus saccharolyticus subsp. saccharolyticus ATCC 43076 Purine riboswitch
 RS: URS0000C0312A_6289
MFE: -17.212
Ligand: lysine
Species: Haemonchus contortus Lysine riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114462 URS000231F385_266940 URS0000C78CDD_1139996 URS0000C0312A_6289
Length 95. 95. 96. 96.
Similarity - 0.981 0.981 0.980
Ensemble Norm 0.852 - - -
MFE -29.047 -32.233 -12.928 -17.212
Ligands - SAM purine lysine
Gene TSPY1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 2.002 3.004 7.
Length SE - 0. 1. 1.
Lev Distance - 25. 24. 23.
UBS 7. 8. 7. 8.
BS 0. 0. 0. 0.
ILL 2. 2. 1. 3.
ILR 2. 2. 2. 2.
H 2. 2. 2. 2.
BL 2. 2. 3. 3.
BR 1. 2. 2. 3.
UN 0.179 0.221 0.240 0.188

Sequences

Field Description
UTR seq + 25 ccuacuuccagaauaaagugauuaccaaggaauaucuggugaacaucacaggugacagguggcucccaggATGCGCCCTGAGGGCTCGCTGACCT
UTR dot + 25 ……………..(((((((((.((……)))))))…))))((((..(((..(((((.((((……)))).)))))..)))))))
RS 1 seq UGUCCAUCCAGAGCGACCGAGAGACCUGGCUCGUCGACGUCGCAGCAACCCCCUGAUCCGUCAGGCGCGGGUGCUUCCGCCAGGACCGAUGGGAG
RS 1 dot …………(((((((((((……))).)))..)))))…….(((..(((.(((..(.(((((….))))))..))).))))))..
RS 2 seq UUUUCAUAAUUAGUUCUUACUUAUAUAUCGUCGUAAUAGGUCGACAGUUUCUACCCGAUACCGGAAUAUCGGACUAUAGGUAAAAAAGUGUUUGUU
RS 2 dot ………………((((((.(((….))))))))).((((.(((.((((..((((((……)))..))).))))..))).))))….
RS 3 seq AGAAAUAGUAGAGGAGCAGGUUUUAGGAGUUUUUUGAAGACGUGACGUCAGAAGUUGUAUGAAAGGAGUAAUUGCCAGUCGUGUGCUACUGCGUAG
RS 3 dot …………….((.((((..(((….)))..)))).))(((.(((.(((..(((((..((……..))..))))).))).))))))..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table