Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114576 Similarity: 0.981 Similarity: 0.980 Similarity: 0.979
UTR: 5HSAA114576
Gene: TTC16
MFE: -35.059
ENS: 0.701
Length: 92.
Predicted Ligands:
zmp-ztp - 7/20
TPP - 5/20
homocysteine - 2/20
 RS: URS0000C2C46F_909613
MFE: -45.758
Ligand: zmp-ztp
Species: Actinokineospora sp. EG49 ZMP/ZTP riboswitch
 RS: URS0000DA5772_1109743
MFE: -40.364
Ligand: zmp-ztp
Species: Streptomyces sp. SCSIO 03032 ZMP/ZTP riboswitch
 RS: URS0000C31423_1114943
MFE: -41.023
Ligand: zmp-ztp
Species: Streptomyces tsukubensis NRRL18488 ZMP/ZTP riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114576 URS0000C2C46F_909613 URS0000DA5772_1109743 URS0000C31423_1114943
Length 92. 92. 92. 93.
Similarity - 0.981 0.980 0.979
Ensemble Norm 0.701 - - -
MFE -35.059 -45.758 -40.364 -41.023
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene TTC16 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 7.001 2.011
Length SE - 0. 0. 1.
Lev Distance - 25. 25. 26.
UBS 7. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 3. 3. 2. 2.
H 2. 2. 2. 2.
BL 3. 3. 1. 3.
BR 1. 2. 2. 1.
UN 0.054 0.022 0.022 0.161

Sequences

Field Description
UTR seq + 25 agcaacgucagggccagggccgcgagguaguuggcagaggccucgggguccuccuggaaggggccucATGACAGATTCGGACGAGGATGCCC
UTR dot + 25 …..(.(((((…((((((.((((((………..)))))).)))))))))))..)(((((((.(((…..)))…)))…))))
RS 1 seq ACCCAGGGCCGUGACUGGCGUGCAGCGGGUGGAAUCGACCACCGGGGAGCGGUCCUGGGCGGAGGACGGCACCGAACGCCUGGGUGUUCCGC
RS 1 dot ..((((((((((..((.(.(((…(((……)))..)))).))..))))))))))((((((.(((((…….)))…)).))))))
RS 2 seq GCACGGGGCCGUGACUGGCGCGUGGGGAUGGGAAGGACCAUCGGGGAGCGGCCCUGUCGAGCGACGUGAAGCCGUGCGCCUGGGCUUUCGCG
RS 2 dot ((((((((((((..((.(…((((…………))))).))..))))))))))…))..(((((((((………))))).))))
RS 3 seq GUCAAGCGCGGCGACUGGCGUACGGGGAGCUCACCCCGAGGGAGCCGUGUGCGCAGGAGCAUCACGAGGGUGCCGACCGCCUGGGUACCCCGG
RS 3 dot ……….((..((.(((((((.((..(((…….)))..)).)))))))))..))….((.(((((((………))))))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table