Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114686 Similarity: 0.977 Similarity: 0.975 Similarity: 0.975
UTR: 5HSAA114686
Gene: TTC23
MFE: -26.666
ENS: 0.864
Length: 114.
Predicted Ligands:
FMN - 20/20 - 20/20


 RS: URS0000C257DE_36849
MFE: -28.423
Ligand: FMN
Species: Oxobacter pfennigii FMN riboswitch (RFN element)
 RS: URS0000DACA19_1797677
MFE: -30.302
Ligand: FMN
Species: Clostridiales bacterium GWB2_37_7 FMN riboswitch (RFN element)
 RS: URS0000C5B757_1354301
MFE: -32.832
Ligand: FMN
Species: Clostridium sp. BL8 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114686 URS0000C257DE_36849 URS0000DACA19_1797677 URS0000C5B757_1354301
Length 114. 115. 114. 114.
Similarity - 0.977 0.975 0.975
Ensemble Norm 0.864 - - -
MFE -26.666 -28.423 -30.302 -32.832
Ligands - FMN FMN FMN
Gene TTC23 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.002 6.022 6.022
Length SE - 1. 0. 0.
Lev Distance - 28. 31. 31.
UBS 8. 8. 7. 7.
BS 0. 0. 0. 0.
ILL 0. 0. 0. 0.
ILR 1. 0. 0. 0.
H 5. 6. 5. 5.
BL 3. 1. 1. 1.
BR 2. 2. 2. 2.
UN 0.158 0. 0.307 0.307

Sequences

Field Description
UTR seq + 25 acucuugcuuccggcuccggcgugggguuugaugucgacggaguggcuuuugcuuagcgucuugaagggaagacaauguauauaaaaauATGCAAGAATCACAGGAAACCCACA
UTR dot + 25 (((((.((.((.((((((…..)))))).)).))….)))))(((….)))….(((((……)))))..(((((((….)))))))………((….))…
RS 1 seq UGAUAUCUUCAGGGCAGGGUUAAAUUCCCUACCGGUGGUAAAGCCCACUAGCCGCAAGGCAUGAUUCGGUGUAACUCCGAAGCCGACAGCAUAGUCUGGAUGAAAGAAGAUAAAG
RS 1 dot (((…..))).((.((((…….)))).))(((((……))))).(((….)))….(((((…….))))).(((((……))).))…………….
RS 2 seq UUGAAUCUUCAGGGCGGGGUGUGAGUCCCCACCGGCGGUAAAGCCCGCGAGCCGUAAGGUUGAUUCGGUGAAAUUCCGAUGCCGACAGUAUAGUCUGGAUGAAAGAAGAUGAUG
RS 2 dot …………((.((((…….)))).)).((((……)))).((((….))))…((((…….))))..(((((……))).))…………….
RS 3 seq AUAAAUCUUCAGGGCGGGGUGUAAGUCCCCACCGGCGGUAUAGCCCGCGAGCCGUAAGGCAGAUUCGGUGUAACUCCGAAGCCGACAGUAAAGUCUGGAUGAAAGAAGAAACUA
RS 3 dot …………((.((((…….)))).)).((((……))))..(((….)))…(((((…….))))).(((((……))).))…………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table