Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114692 Similarity: 0.945 Similarity: 0.945 Similarity: 0.943
UTR: 5HSAA114692
Gene: TTC23_0
MFE: -32.852
ENS: 0.636
Length: 184.
Predicted Ligands:
cobalamin - 14/20
lysine - 3/20
glucosamine - 1/20
 RS: URS0002315EB1_1337886
MFE: -58.693
Ligand: cobalamin
Species: Sporomusa sphaeroides DSM 2875 Cobalamin riboswitch
 RS: URS000231AE58_1653334
MFE: -63.899
Ligand: cobalamin
Species: Rhizobiales bacterium HL-109 Cobalamin riboswitch
 RS: URS0000DA53D4_392015
MFE: -84.157
Ligand: glucosamine
Species: Alicyclobacillus macrosporangiidus glmS glucosamine-6-phosphate activated ribozyme
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114692 URS0002315EB1_1337886 URS000231AE58_1653334 URS0000DA53D4_392015
Length 184. 183. 184. 183.
Similarity - 0.945 0.945 0.943
Ensemble Norm 0.636 - - -
MFE -32.852 -58.693 -63.899 -84.157
Ligands - cobalamin cobalamin glucosamine
Gene TTC23 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 27. 3.023 5.018
Length SE - 1. 0. 1.
Lev Distance - 55. 72. 72.
UBS 16. 13. 17. 15.
BS 0. 0. 0. 0.
ILL 3. 3. 3. 4.
ILR 6. 4. 5. 7.
H 4. 3. 4. 3.
BL 7. 4. 7. 7.
BR 3. 5. 4. 4.
UN 0.190 0.186 0.038 0.055

Sequences

Field Description
UTR seq + 25 aaaaggcugcuccggaacugcccuacuuuagacuuuuucaugguuaucaaucuguacaaagaaucaccaaacugauaaagcaggaaccagagggcaaaucacgcugccaagacaacuguguaauucgcucgaaaaagaaacgacaauguauauaaaaauATGCAAGAATCACAGGAAACCCACA
UTR dot + 25 ….(((.((….((..((((((.((((.(.((((.(((((((.((…(((……))))).))))…))).)))))..))…))))))))..))..)).)))…………….(((.((……))..)))…(((((((….)))))))………((….))…
RS 1 seq AUGAAUAUCGUUGGGAUAGGUGCCCUACGGGGCUUAAUAGGGAAGUCCGGUGCAAUGCCGGCGCGGUCCCGCCACUGUAACGGGGAGCAAUCUCGCAGAUAUGCCACUGGAGCGAACGCUUUGGGAAGGUGCGAGAAAGCAAUGAACCGGAGCCAGGAGAACUGCCUGUCUGACAAUCACCGU
RS 1 dot ….(((((..((((((.(.(.(((((((((((……((((.(((((((…..))))).))..))))))).)))))..))).).).))))))..)))))……………(((((((…..(((……)))…..)))))))((((…….))))……………
RS 2 seq UGGCCCCUUGCCGUGGUCGGCGCCCUUUCGGGCCCAACAGGGAAACCGGUGCGAGACCGGUGCUGCUCCCGCAACUGUAAUCGGUGAGCCCGUCCGAAAGCCACUGGUGCCCCGCGCACCGGGAAGGUGGACAUCGCGGUGAUGACCCGAGAGCCAGGAGACCUGCCGACGUGAAGCAACCCUG
RS 2 dot .((((((((((.((((.(((((((.(((((.(((…..((….))))).)))))..)))))))…))))….))))..)).).))).((((….(((.(((((((…..)))))))…))))))).(((.(((….))))))….((((.(…(((………))).)))))
RS 3 seq GGCAUGACACAAGCGCCUGGACUGUGCGGUCCGCGCGCCCCUCAGGGUGCCGCGGAUUGGGAACAGUUGACGCGGAGGAGGUCAGCGAACCAUUCGGCGGGUGCCUCCCGGUGUGCGCCGCACCGCGAGCGAAGCUCGAAAGCCGCCGGGCGACCGGCGGGACAAGGGCGAGCAGGCGAAUGA
RS 3 dot .((.((((.(…(((.(.((((((.((((((((((((((….)))))).))))))))…)))))).).)))…)..))))))……..(((((.(((((….))))).)))))((.(((..((…((((…..(((((((….)))))))…..))))..))..)))..)).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table