Detected as a riboswitch by 18 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114711 Similarity: 0.973 Similarity: 0.972 Similarity: 0.972
UTR: 5HSAA114711
Gene: TTC26
MFE: -28.881
ENS: 0.942
Length: 105.
Predicted Ligands:
TPP - 15/20
glycine - 2/20
fluoride - 1/20
RS: URS000152F4C0_301
MFE: -30.129
Ligand: TPP
Species: Pseudomonas oleovorans TPP
RS: URS0000AB2C33_1026882
MFE: -30.810
Ligand: TPP
Species: Methylophaga aminisulfidivorans MP TPP riboswitch (THI element)
RS: URS0000DA09E7_1577903
MFE: -29.471
Ligand: TPP
Species: Ruegeria sp. ANG-R TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114711 URS000152F4C0_301 URS0000AB2C33_1026882 URS0000DA09E7_1577903
Length 105. 107. 105. 106.
Similarity - 0.973 0.972 0.972
Ensemble Norm 0.942 - - -
MFE -28.881 -30.129 -30.810 -29.471
Ligands - TPP TPP TPP
Gene TTC26 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 7.018 7.
Length SE - 4. 0. 1.
Lev Distance - 29. 34. 33.
UBS 10. 9. 9. 9.
BS 0. 0. 0. 0.
ILL 4. 5. 3. 4.
ILR 5. 5. 3. 3.
H 2. 2. 2. 2.
BL 4. 2. 3. 3.
BR 1. 0. 1. 2.
UN 0.038 0.028 0.171 0.057

Sequences

Field Description
UTR seq + 25 agaacgugcuguguggaugcggcgaaacgcugaggcgcggccuucguugugugguggggacucacaagaccgacgucaagATGATGCTTTCAAGGGCCAAACCTG
UTR dot + 25 (.((((.(((((((….(((……)))….)))))))…)))).)..(((..((.(((….((..(.(((((…))))))..))..)))))..)))..
RS 1 seq GAGUUCUUGUCGGGGUGCCCCAAAUGCGGGGCUGAGAUUGGCAGCUGCCGGAUCCCGUUGAACCUGAUCAGGUUAAGGCCUGCGUAGGGAACAAGAUGUCCUCGCCA
RS 1 dot .(((…((((((…(((((……)))))…..)))))))))((.((((..(.(((..((((..(((((….)))))..))))…))))..))))..))..
RS 2 seq AAUGAUGCCUCGGGGUGGCGAAAGCCUGAGAUGCUCGUUUAAAGAGCGGACCCGAUGAACCUGAUCCAGUUAAUACUGGCGUAGGGACAGGCUGAAAUAGAUCUU
RS 2 dot (((((.((((((((.(……).))))))..)))))))…….(((.((…((..((((..(((((….)))))..))))..)))))))………..
RS 3 seq AGGCCUACCUCGGGGUGCGCUCAAGACUGCGCUGAGAUGCCAACAGGCGAACCCGUUGAACCUGAACCGGCUAGAACCGGCGGAGGGAAAGGUAAAGGUUUCGUCC
RS 3 dot .(((….((((….((((……..))))))))..)))….((((((.((.((..((((…((.(((……)))…))…)))).)))).)))))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table