Detected as a riboswitch by 8 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114712 Similarity: 0.965 Similarity: 0.963 Similarity: 0.963
UTR: 5HSAA114712
Gene: TTC26_0
MFE: -41.895
ENS: 0.861
Length: 139.
Predicted Ligands:
FMN - 6/20
cobalamin - 4/20
TPP - 3/20
 RS: URS0000D8A512_1956175
MFE: -55.023
Ligand: FMN
Species: candidate division KSB1 bacterium 4484_188 FMN riboswitch (RFN element)
 RS: URS0000AB9F1A_657324
MFE: -38.916
Ligand: FMN
Species: Butyrivibrio fibrisolvens 16/4 FMN riboswitch (RFN element)
 RS: URS0002312D47_251221
MFE: -50.126
Ligand: cobalamin
Species: Gloeobacter violaceus PCC 7421 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114712 URS0000D8A512_1956175 URS0000AB9F1A_657324 URS0002312D47_251221
Length 139. 139. 140. 138.
Similarity - 0.965 0.963 0.963
Ensemble Norm 0.861 - - -
MFE -41.895 -55.023 -38.916 -50.126
Ligands - FMN FMN cobalamin
Gene TTC26 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 12.004 21.007 12.
Length SE - 0. 1. 1.
Lev Distance - 41. 37. 42.
UBS 12. 12. 10. 12.
BS 0. 0. 0. 0.
ILL 4. 2. 4. 4.
ILR 3. 3. 1. 2.
H 4. 4. 4. 3.
BL 4. 6. 1. 3.
BR 2. 4. 4. 5.
UN 0.086 0.151 0.171 0.087

Sequences

Field Description
UTR seq + 25 cguaccagcguccaggcgggguuaccguggagacagaacgugcuguguggaugcggcgaaacgcugaggcgcggccuucgcugugugguggggacucacaagaccgacgucaagATGATGCTTTCAAGGGCCAAACCTG
UTR dot + 25 ……..((((((.((((.(….(((………)))).)))).))))))(((((…)))))..(((((((….)))))))(((..((.(((….((..(.(((((…))))))..))..)))))..)))..
RS 1 seq CACGAUCUUUGGGGCAAGGUGACCCCGGUUUUGCCGGGGGAUUCCUGACCGGCGGUGAAAGCCCGCGAGUCCCGGUAAACGGGACAGAACCGGUGAAAUUCCGGUGCCGACGGUACAGUCCGGAUGGGAAAAGAUCGCC
RS 1 dot …………((..(((.(.(((((((…)))))))..).)))..)).((((.(….)))))..((((((…..))))))……(((((..((((.((.(.(((……))).).)).))))….)))))
RS 2 seq GGAAAUCUUCAGGGCAAGGUGCGAAAGCGUUAGCUUUCAAUUCCUGACCGGCGGUAUAGUCCGCGAGUCUUAUUUUUAAAUAGGACCGAACUGGUGUGAUUCCAGUACCGACAGUAUAGUCUGGAUGGAAGAAGAUGUGC
RS 2 dot ……..((((((….((..((((((….)))))).))))))))…((((……))))..((((((((….))))))))…….((.(..(((((…(((((……))).)).)))))..).))….
RS 3 seq UAGAAUCGCUUCGCUUGCGGCGGCCGGGGGAUCAGCCCGGCCUGAAUGGGGAAAGCGUGGUGAGAAUCCACCGCUGUGCCGCAACUGUGAUGGCGAUUGUGCCUGAGCCAGGAUGCCCGCCGAGAGUGCUUCACGUCC
RS 3 dot …….(((((.((……(((((((…….)))))))…..)).))).))((((((……)))))).(((..((.(((.(..(((((…(((((((…)))).))).)))))).)))))..)))….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table