Detected as a riboswitch by 10 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114752 Similarity: 0.990 Similarity: 0.989 Similarity: 0.989
UTR: 5HSAA114752
Gene: TTC30A
MFE: -15.884
ENS: 0.825
Length: 43.
Predicted Ligands:
preQ_1 - 10/20
SAM - 9/20
unknown - 1/20
 RS: URS00021EE107_12908
MFE: -7.110
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS00021EE16E_12908
MFE: -9.748
Ligand: SAM
Species: unclassified sequences SAM-SAH-Weickhmann-2018 RNA
 RS: URS0000C7BA37_1679168
MFE: -7.297
Ligand: preQ_1
Species: Bacillus sp. FJAT-27231 PreQ1 riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114752 URS00021EE107_12908 URS00021EE16E_12908 URS0000C7BA37_1679168
Length 43. 43. 43. 44.
Similarity - 0.990 0.989 0.989
Ensemble Norm 0.825 - - -
MFE -15.884 -7.110 -9.748 -7.297
Ligands - SAM SAM preQ_1
Gene TTC30A - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.005 4.005 1.001
Length SE - 0. 0. 1.
Lev Distance - 12. 14. 14.
UBS 3. 4. 3. 3.
BS 0. 0. 0. 0.
ILL 0. 0. 1. 0.
ILR 0. 0. 1. 0.
H 2. 2. 2. 2.
BL 1. 2. 0. 0.
BR 1. 2. 0. 1.
UN 0.116 0.186 0.047 0.091

Sequences

Field Description
UTR seq + 25 auaacagccguggugguuATGGCTGGTCTGAGCGGCGCGCAGA
UTR dot + 25 ….((((((((…..)))))))).((((.((…)).))))
RS 1 seq GCUACAACGGCUUCCUGGCGUAGUUUGAAAAUUAAUUGGAGCA
RS 1 dot ……(((.(…..).))).((((.((……)).)))).
RS 2 seq CACGCAACGGCUUCCUGACGCGUGAGUUUAAAUUAUUGGAGCA
RS 2 dot (((((..(((….)))..))))).((((………)))).
RS 3 seq GCAGGAGAGGUUCGCGAACUCCCUCUAUAAAAAACUAUGAGAGA
RS 3 dot …((((………..))))(((((((……))).)))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table