Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114867 Similarity: 0.985 Similarity: 0.985 Similarity: 0.985
UTR: 5HSAA114867
Gene: TTF1
MFE: -17.781
ENS: 0.958
Length: 77.
Predicted Ligands:
SAM - 9/20
zmp-ztp - 8/20
fluoride - 3/20
 RS: URS0000D782F4_1121322
MFE: -19.329
Ligand: zmp-ztp
Species: Anaerocolumna jejuensis DSM 15929 ZMP/ZTP riboswitch
 RS: URS0000D8CB46_1450648
MFE: -19.292
Ligand: zmp-ztp
Species: Clostridium oryzae ZMP/ZTP riboswitch
 RS: URS0001C5D0AE_1898207
MFE: -19.338
Ligand: zmp-ztp
Species: Clostridiales bacterium pfl
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114867 URS0000D782F4_1121322 URS0000D8CB46_1450648 URS0001C5D0AE_1898207
Length 77. 77. 77. 77.
Similarity - 0.985 0.985 0.985
Ensemble Norm 0.958 - - -
MFE -17.781 -19.329 -19.292 -19.338
Ligands - zmp-ztp zmp-ztp zmp-ztp
Gene TTF1 - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 3.001 3.001 3.001
Length SE - 0. 0. 0.
Lev Distance - 19. 19. 19.
UBS 4. 4. 4. 4.
BS 0. 0. 0. 0.
ILL 1. 2. 2. 2.
ILR 0. 1. 1. 1.
H 2. 2. 2. 2.
BL 1. 0. 0. 0.
BR 1. 1. 1. 1.
UN 0.221 0.247 0.247 0.247

Sequences

Field Description
UTR seq + 25 agcagcacuuccggguugggagaaagguggcggcgcuuucggagggaauaaaATGTACCGGGACGACTTGGAACGGT
UTR dot + 25 …….(((((((……….(((((….))))))))))))……..(((.(((((….))))).)))..
RS 1 seq AAAGGGUCAUAUGACUGACGGAUGUGGAUAACCACAAGGGAGUAUGACAGAAAGAGCCGACCGUCUGGGCAAGUAGU
RS 1 dot …..(((((((..((……(((((….))))).))..)))))))…….(((………)))…….
RS 2 seq UAAGAGUCAUAUGACUGACGGAUGUGGAUUACCACAAGGGAGUAUGACGGAAAAGGCCGACCGUCUGGGCAAACCAC
RS 2 dot …..(((((((..((……(((((….))))).))..)))))))…….(((………)))…….
RS 3 seq CAGGAGUCAUAUGACUGACGGAUGUGGAGAACCACAGGGGAGUAUGACGGAAAAAGCCGACCGUCUGGGCAGAACAG
RS 3 dot …..(((((((..((……(((((….))))).))..)))))))…….(((………)))…….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table