Detected as a riboswitch by 1 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114873 Similarity: 0.958 Similarity: 0.958 Similarity: 0.957
UTR: 5HSAA114873
Gene: TTK
MFE: -56.649
ENS: 0.770
Length: 149.
Predicted Ligands:
FMN - 8/20
cobalamin - 4/20
TPP - 4/20
 RS: URS0000D941D2_501024
MFE: -49.504
Ligand: FMN
Species: Rhizobium tibeticum FMN riboswitch (RFN element)
 RS: URS000232FBCB_65393
MFE: -36.740
Ligand: cobalamin
Species: Cyanothece sp. PCC 7424 Cobalamin riboswitch
 RS: URS0000C3D545_1262947
MFE: -35.017
Ligand: FMN
Species: Roseburia sp. CAG:45 FMN riboswitch (RFN element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114873 URS0000D941D2_501024 URS000232FBCB_65393 URS0000C3D545_1262947
Length 149. 151. 148. 149.
Similarity - 0.958 0.958 0.957
Ensemble Norm 0.770 - - -
MFE -56.649 -49.504 -36.740 -35.017
Ligands - FMN cobalamin FMN
Gene TTK - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 10.008 8.008 10.002
Length SE - 4. 1. 0.
Lev Distance - 45. 51. 52.
UBS 13. 11. 12. 12.
BS 0. 0. 0. 0.
ILL 1. 0. 0. 3.
ILR 3. 2. 3. 3.
H 4. 4. 5. 3.
BL 7. 5. 5. 5.
BR 5. 5. 4. 5.
UN 0.148 0.238 0.061 0.188

Sequences

Field Description
UTR seq + 25 guagguaaguucugucuuaccggugcaccggcgcacugaggaacagccgcagccgguguaggggcucauuguuagcgcuggucggugagggguggggcgaggugggggcagcucggagccagaaATGGAATCCGAGGATTTAAGTGGCA
UTR dot + 25 …((((((……))))))..(((((((((((.(((…..)))..)).)))))))))..(.(((..(.((.((.(((.((……)).))).)))).)..))).)..((((((.(((….)))..))))))………….
RS 1 seq GGUUGUUCUCAGGGCGGGGUGAAAGUCCCCACCGGCGGUAAGAGCUUCGGCUCAAGCCCGCGAGCGUCUUUCGGCCGAUCUGCCGAAAGGGUCAGCAGAUCCGGUGCAACUCCGGAGCCGACGGUCACAGUCCGGAUGAAAGAGAAUGAGC
RS 1 dot …………((.((((…….)))).))(((.(.((((((((.(((….)))…)))).)))).).)))(((((((.((…..)).)))))))………(((((((((…)))…..))))))……………
RS 2 seq AACGUUAGGGGAUGUUUUGGUUCUAAUGGAGAGCAGCCAUUAGAAGUAAGGGGGAAAGUUCGGUGAAAAUCCGUCGCUGUCCCGCAACUGUGAUGAGAUUAACUUUUAUUCUCUAAGUCAGGAUGCCCGCCAAGCAAAAGUUCCCGAA
RS 2 dot ((((((….))))))(((.(((((((((…….))))))))).)))(.((((.(((.(((…….)))..))).)))).)…..((((((((.(((…))).))))…))))((((((…….)))…..)))….
RS 3 seq GGAAGUCUUCGGGGCAGGGUGAUAUGCGAAGCAUAGAUUCCCGACCGACGGUGAUUGUGCAUGACACAUUAGUCCGUGAACUGUAGUAUUGCAGUUGAUUUGGUGAAAAUCCAAAACCGACAGUAUAGUCUGGAUGGGAGAAGAUAAGU
RS 3 dot …((((.(((.((..(((.(.(((((…)))))..).)))..))..))).))))……….((((((…((.(((((((….))))))).))))))))….((((…(((((……))).)).))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table