Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114956 Similarity: 0.975 Similarity: 0.973 Similarity: 0.972
UTR: 5HSAA114956
Gene: TTPAL
MFE: -60.727
ENS: 0.988
Length: 125.
Predicted Ligands:
TPP - 9/20
molybdenum - 4/20
cobalamin - 2/20
 RS: URS0000D8D365_1802180
MFE: -33.153
Ligand: molybdenum
Species: Spirochaetes bacterium GWC1_61_12 Moco (molybdenum cofactor) riboswitch
 RS: URS0000AB721E_290317
MFE: -25.941
Ligand: TPP
Species: Chlorobium phaeobacteroides DSM 266 TPP riboswitch (THI element)
 RS: URS000231CEB9_326475
MFE: -46.465
Ligand: cobalamin
Species: Burkholderia sp. LMG 22936 Cobalamin riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114956 URS0000D8D365_1802180 URS0000AB721E_290317 URS000231CEB9_326475
Length 125. 125. 124. 124.
Similarity - 0.975 0.973 0.972
Ensemble Norm 0.988 - - -
MFE -60.727 -33.153 -25.941 -46.465
Ligands - molybdenum TPP cobalamin
Gene TTPAL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 34. 5.004 3.002
Length SE - 0. 1. 1.
Lev Distance - 21. 34. 36.
UBS 7. 11. 8. 6.
BS 0. 0. 0. 0.
ILL 2. 1. 1. 1.
ILR 1. 2. 2. 1.
H 3. 3. 2. 3.
BL 2. 6. 2. 1.
BR 2. 2. 3. 2.
UN 0. 0. 0.266 0.242

Sequences

Field Description
UTR seq + 25 gcagggagugcgggucgguucugcgugcgcugccggacgaggcucccgccgccgauugacccgcgcuccgcccguagucgggccgggaccuugguagcuaATGTCCGAAGAAAGTGACTCTCTGA
UTR dot + 25 ….((((((((((((((((..(((.(((..(((……)))…)))))).))))))))))))))))(((((….)))))..((((.((((…)))).))))……………….
RS 1 seq UCUCAGUGUCAUCUCCGAGUUUCACUGGACCUACAGCUGGUGGGCAGCCAUGGCCGGAAACCGAUGAGCCGCAGGCGAAAGGCUGCGACUUCCCGUAUUUGGAAAGGAACAUGACCAUGAACAAC
RS 1 dot …..((.(((((((((.((..((.(((.(((((…..)))))…)))))))))))….)))))))(((((.(….).))))).(((.(((….))).)))……………….
RS 2 seq AUAUCAUCUUGGGGGUGCUGUCUUUUCCACUGUCUUCAGUGACCACCGGUAAACGAUAGCUGAGAUUAAACCCUUGUAACUUGAUGCAGGUAAUGCUGACGCAAGAAAAGAUGAAGCUGGCCUU
RS 2 dot ……….((((((((((((.(((((…(((……)))….)).))).))))))………))))))….((((.(((((……))).))))))……………….
RS 3 seq CUAGAAUGGCAAGCUUGCAGUGCGAGGAAGUCGGUGAAAACCCGGCACGGUCGCGCCACUGUGAGCGUGUGUGCCGAUGCGGCGCGCGCGCGAGUCAGACCCUCGCUGCAUUCUUUCCUUCCUC
RS 3 dot …………((((((((((((.((..(((((…….)))))….)).))).)))))))))((((((((((…))))))))))(((((…….)))))………………

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table