Detected as a riboswitch by 2 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114957 Similarity: 0.960 Similarity: 0.959 Similarity: 0.957
UTR: 5HSAA114957
Gene: TTPAL_0
MFE: -80.648
ENS: 0.830
Length: 168.
Predicted Ligands:
TPP - 13/20
Mg2+ - 4/20
cobalamin - 2/20
 RS: URS0000C8341A_1442369
MFE: -44.366
Ligand: TPP
Species: Rhinocladiella mackenziei CBS 650.93 TPP riboswitch (THI element)
 RS: URS0000C14C76_858893
MFE: -50.566
Ligand: TPP
Species: Exophiala dermatitidis NIH/UT8656 TPP riboswitch (THI element)
 RS: URS0000ABA47E_868595
MFE: -50.301
Ligand: Mg2+
Species: Desulfotomaculum carboxydivorans CO-1-SRB M-box riboswitch (ykoK leader)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114957 URS0000C8341A_1442369 URS0000C14C76_858893 URS0000ABA47E_868595
Length 168. 168. 168. 168.
Similarity - 0.960 0.959 0.957
Ensemble Norm 0.830 - - -
MFE -80.648 -44.366 -50.566 -50.301
Ligands - TPP TPP Mg2+
Gene TTPAL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 5. 6. 3.
Length SE - 0. 0. 0.
Lev Distance - 51. 51. 56.
UBS 13. 14. 13. 14.
BS 0. 0. 0. 0.
ILL 6. 6. 6. 6.
ILR 4. 3. 3. 5.
H 2. 3. 3. 2.
BL 5. 4. 3. 5.
BR 5. 6. 5. 6.
UN 0.054 0.042 0.042 0.048

Sequences

Field Description
UTR seq + 25 gagaggccgggcaggccgggcagggagugcgggucgguucugcgugcgcugccggacgaggcucccgccgccgauugacccgcgcuccgcccguagucgggccguucuguuccaagagauaaccauugggaccuugguagcuaATGTCCGAAGAAAGTGACTCTCTGA
UTR dot + 25 (((.((((.(((….(((((..((((((((((((((((..(((.(((..(((……)))…)))))).)))))))))))))))))))))..))).)))).)))…….(((((..((..((.((((.((((…)))).)))).))….))…)))))..
RS 1 seq GUGCAGCACUACGGGCGCUUGUGUGGACAUUCCUCGCAUUCAUCCACCUGAUCCUUCUCCAAAGAGACCAGAGAUGAACGAGUUUCAAUGUCGGACACAAUGCUGAGAUUGUACCGUUAUGACUCGAUCAAGUUAAUGCUUGCGUGGGAAACGUGCUGCCGCUUCUCC
RS 1 dot ((((((..((…((((.((((((.((((((.((((..((((((…(((.(((((…..))).)).))).))))))))))….))))))..)))))))))).)).))))))((((….((((..(((((….)))))..)))).)))).((….))……
RS 2 seq GUGCAGCACUACGGGCGCUUGUGUGGCAAUCCUCACCCUUCAUCCACCUGGUCUUUGAAUUUGACCAGAGAUGAGGCGAGCUGCUAUUGCCGAAACACAAUGCUGAGAUUGUACCGUUAGAACUCGAACAAGUUAAUGCUUGCGUGGGAAACGUGCUGCCGCUUCUCC
RS 2 dot ((((((..((…((((.((((((((((((.(((.((..(((((…((((((………)))))).))))))).)))…..))))))…)))))))))).)).))))))((((….((((..(((((….)))))..)))).)))).((….))……
RS 3 seq AUUUAGCUUCGUUAGGUGAGGCUUCUGCAUAGACAAAUGCCACUGCCCGGAAAUGUCGAGAGACGCUAACGGGUUAACAGGUUCUACCGGCUUAAGGUUAUACCUAAUGUGGCUGGGACAAGUGCCCUAGCUAUGUAUGUGCCAAAGCUUGCACGAGUGGAGAAGGCC
RS 3 dot .(((((((.(((((((((((.(((..((.((((…..(((…(((((..(.((((….)))).)..)))))…..)))))))…))..))).)).))))))))).)))))))……(((.(..((((…(((((……..))))).))))..).))).

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table