Detected as a riboswitch by 20 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114958 Similarity: 0.960 Similarity: 0.958 Similarity: 0.958
UTR: 5HSAA114958
Gene: TTPAL_1
MFE: -65.273
ENS: 0.972
Length: 149.
Predicted Ligands:
FMN - 6/20
glucosamine - 5/20
cobalamin - 3/20
 RS: URS0000ABB374_491952
MFE: -43.423
Ligand: FMN
Species: Marinomonas posidonica IVIA-Po-181 FMN riboswitch (RFN element)
 RS: URS000231A61A_875328
MFE: -60.550
Ligand: cobalamin
Species: Mycobacterium sp. JDM601 Cobalamin riboswitch
 RS: URS0000ABCA16_1352
MFE: -32.914
Ligand: glucosamine-6-phosphate
Species: Enterococcus faecium glmS
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114958 URS0000ABB374_491952 URS000231A61A_875328 URS0000ABCA16_1352
Length 149. 148. 148. 148.
Similarity - 0.960 0.958 0.958
Ensemble Norm 0.972 - - -
MFE -65.273 -43.423 -60.550 -32.914
Ligands - FMN cobalamin glucosamine-6-phosphate
Gene TTPAL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7.004 8.003 4.009
Length SE - 1. 1. 1.
Lev Distance - 49. 51. 53.
UBS 10. 12. 11. 10.
BS 0. 0. 0. 0.
ILL 4. 4. 6. 3.
ILR 3. 3. 4. 4.
H 3. 4. 2. 2.
BL 3. 4. 3. 4.
BR 3. 2. 2. 3.
UN 0.121 0.054 0.068 0.027

Sequences

Field Description
UTR seq + 25 gcagggagugcgggucgguucugcgugcgcugccggacgaggcucccgccgccgauugacccgcgcuccgcccguagucgggccguucuguuccaagagauaaccauugggaccuugguagcuaATGTCCGAAGAAAGTGACTCTCTGA
UTR dot + 25 ….((((((((((((((((..(((.(((..(((……)))…)))))).))))))))))))))))(((((….)))))…………(((((..((..((.((((.((((…)))).)))).))….))…)))))..
RS 1 seq UUUCGUUCUCGGGGCGGGGUGAAAUUCCCCACCGGCGGUAAAGAAUUCAUUUCUAAGCCCGCGAGCGCCUAGUCUACUUUGAUUAGGGUCAGCAGAUCUGGUGAGACUCCAGAGCCGACGGUUAUAGUCCGGAUGAUAGAGAGCGCGU
RS 1 dot …(((((.((((..((((((.(((((…(((…)))…)))))))))))….)))).)))))(((((((……)))))))….((…(((((…….)))))))((.((.((…(((…..)))…)).)))).
RS 2 seq AUGGGCUUGGGUGGGCACGGUGUUAGGGUAUCGGCGCGAACUGCCAGGGAAGUCGGUGUGAGUCCGACACAGGCCCGCUACGGUGUUCCGCGGCGCAUUCCGGUGCGCCACGGUCAGUCCGAAUACCGGCUUCGCGUUGCCAACACCG
RS 2 dot ………(((((((.(.(((((..((..((.((((..(((……..)))..))))))..))))))).)))))))).(((((((..(((((((…((((((…..(((…..)))..))))))….))))))).)))))))
RS 3 seq CCUUUUAGGAUAGCGCCAGGUCUGUGUAAACAGAUGACGAGGAGAGGGUUUAUCGAAAGAUUCGGCGGAUGGCCCUAGGGACUGCACUCUACAGAAAAUCCACAAAAAAUGUCUGCAAAGAUAAAACAAAAGGAUUUUCCUGCAGCUG
RS 3 dot (((..((((.((.((((.(((((.(((((((…………….))))).))..))))).))))..))..))))))).(((((…….((((((((……..(((((….)))))……..)))))))).)))))…

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table