Detected as a riboswitch by 17 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114960 Similarity: 0.973 Similarity: 0.968 Similarity: 0.967
UTR: 5HSAA114960
Gene: TTPAL_2
MFE: -73.332
ENS: 0.925
Length: 146.
Predicted Ligands:
TPP - 7/20
FMN - 6/20
cobalamin - 4/20
 RS: URS0000D7DA51_796027
MFE: -28.657
Ligand: TPP
Species: Candida lignohabitans TPP riboswitch (THI element)
 RS: URS0000AB4FD4_391008
MFE: -63.570
Ligand: FMN
Species: Stenotrophomonas maltophilia R551-3 FMN riboswitch (RFN element)
 RS: URS0000D82631_1897630
MFE: -50.548
Ligand: TPP
Species: Motiliproteus sp. MSK22-1 TPP riboswitch (THI element)
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114960 URS0000D7DA51_796027 URS0000AB4FD4_391008 URS0000D82631_1897630
Length 146. 146. 146. 145.
Similarity - 0.973 0.968 0.967
Ensemble Norm 0.925 - - -
MFE -73.332 -28.657 -63.570 -50.548
Ligands - TPP FMN TPP
Gene TTPAL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 7. 13.005 27.
Length SE - 0. 0. 1.
Lev Distance - 33. 38. 31.
UBS 9. 11. 11. 6.
BS 0. 0. 1. 0.
ILL 4. 3. 2. 3.
ILR 2. 2. 4. 4.
H 2. 2. 2. 2.
BL 3. 4. 3. 1.
BR 3. 4. 3. 0.
UN 0.178 0.199 0.110 0.179

Sequences

Field Description
UTR seq + 25 gcgagaggccgggcaggccgggcagggagugcgggucgguucugcgugcgcugccggacgaggcucccgccgccgauugacccgcgcuccgcccguagucgggccgggaccuugguagcuaATGTCCGAAGAAAGTGACTCTCTGA
UTR dot + 25 ……((((.(((….(((((..((((((((((((((((..(((.(((..(((……)))…)))))).)))))))))))))))))))))..))).)))).((((.((((…)))).))))……………….
RS 1 seq CACAUGCAUAGCCGGUGCCUUAUCUCUAGCAGGACCACUGACGUGAUUAUACAUUACUGUCUGACUUGCUUAGGAUUUGUGCUGAGAUUAUACGGCUGAACUUGAUCUAGAUAACACUAGCGAUAAGGAUAUGCAUUCUACCCCUG
RS 1 dot ……..(((((((((….(((((.((((.((…((((.(((((((.(((….))).))).))))))))…)).)))))))))))).))))))..((((..((((……))))…))))……………….
RS 2 seq AAACGUCUUCAGGGCGGGGUGCGAUUCCCCACCGGCGGUAGGUGCGCAAGCACGAGCCCGCGAGCGCUCCGGCCUUACCGCCGGGGGUCAGCAGAUCCGGUCCAAUGCCGGAGCCGACGGUAUAGUCCGGAUGAAAGAAGACGGUG
RS 2 dot …(((((((.((((.((((((((…(((.((((((((((((((((..((……..))..))))….)))).))))))))))))).)))..))).))))….((((((((…)))….)))))……)))))))…
RS 3 seq UCCGUCUCAUCGGGGUGCUUUUAAGGUUUCUGUCAAUAAGCAAUCAAUCCACUCCCAUUGCUUAUUGACAGGAGCCCUGGCUGAGAGUUUACCCGUCGAACCUGAUCCAGUUAACACUGGCGUAGGAAAUGAGCAUUCCAAGGUA
RS 3 dot ……((..((((..(((((((.((((((((((((((((((((…………))))))))))))))))))))…..)))))))…))))..)).((((..(((((….)))))..))))……………….

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table