Detected as a riboswitch by 4 out of 20 classifiers
arrow left to previous 5prime UTR page
5HSAA114962 Similarity: 0.964 Similarity: 0.961 Similarity: 0.961
UTR: 5HSAA114962
Gene: TTPAL_3
MFE: -70.635
ENS: 0.760
Length: 145.
Predicted Ligands:
FMN - 5/20
glycine - 4/20
cobalamin - 4/20
 RS: URS0000C5ABD9_1761910
MFE: -38.828
Ligand: molybdenum
Species: Vibrio sp. MEBiC08052 Moco (molybdenum cofactor) riboswitch
 RS: URS0000DB4638_393763
MFE: -30.974
Ligand: glycine
Species: Anaerobacillus alkalilacustre Glycine riboswitch
 RS: URS0000B7CC9B_474394
MFE: -47.428
Ligand: molybdenum
Species: Vibrio mangrovi Moco (molybdenum cofactor) riboswitch
image of 5prime UTR secondary structure image of the secondary structure of the first Riboswitch match image of the secondary structure of the second Riboswitch match image of the secondary structure of the third Riboswitch match
circular plot of the 5prime UTR base pairs circular plot of the 5prime UTR base pairs compared with the first Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the second Riboswitch base pairs circular plot of the 5prime UTR base pairs compared with the third Riboswitch base pairs
line plot comparing the structural features of the 5prime UTR with its first riboswitch match line plot comparing the structural features of the 5prime UTR with its second riboswitch match line plot comparing the structural features of the 5prime UTR with its third riboswitch match
arrow right to the next 5prime UTR page
heatmap comparing sequence features of the 5prime UTR and top three riboswitch matches
Heatmap of base pair probabilities for 1000 computational NUPACK foldings of the 5prime UTR
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon unbound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR that leave the start codon bound
Heatmap of base pair probabilities for computational NUPACK foldings of the 5prime UTR with the bound and unbound conformers overlaid
ML ensemble output for the 5prime UTR

Information

  5’UTR RS match 1 RS match 2 RS match 3
Link - RNAcentral RNAcentral RNAcentral
ID 5HSAA114962 URS0000C5ABD9_1761910 URS0000DB4638_393763 URS0000B7CC9B_474394
Length 145. 143. 145. 143.
Similarity - 0.964 0.961 0.961
Ensemble Norm 0.760 - - -
MFE -70.635 -38.828 -30.974 -47.428
Ligands - molybdenum glycine molybdenum
Gene TTPAL - - -
Downstream protein Genecard - - -

Similarity metrics

  5’UTR RS match 1 RS match 2 RS match 3
Struct SE - 6.005 13. 13.005
Length SE - 4. 0. 4.
Lev Distance - 40. 47. 42.
UBS 10. 10. 11. 9.
BS 0. 0. 0. 0.
ILL 5. 3. 6. 2.
ILR 1. 1. 4. 0.
H 3. 3. 3. 3.
BL 1. 2. 0. 2.
BR 4. 5. 3. 5.
UN 0.062 0.133 0.076 0.133

Sequences

Field Description
UTR seq + 25 cgggcagggagugcgggucgguucugcgugcgcugccggacgaggcucccgccgccgauugacccgcgcuccgcccguagucgggccgggcuucucuguuggcagggaccuugguagcuaATGTCCGAAGAAAGTGACTCTCTGA
UTR dot + 25 (((((..((((((((((((((((..(((.(((..(((……)))…)))))).)))))))))))))))))))))((((…((((((..((((((….)))))).)))))).))))..((((…….).)))…….
RS 1 seq UAGUUGCCAUAGCUCCGAGUUUUUCGGGCUAAGUUCCGGAUGGAAUAGGCUUGUUAAACCUGUGGUCGAUGUUGAUGACCCGAGGGUGGGAUUGGAAAUGAUCUUGCCUCCCGUGUUUGGAAAGGUGUUCCAUGGCUCAAUUU
RS 1 dot ..((((((((((……((((..((((((..(((((….))))).))))))..)))))))))).))))……(((.((.(((((((((((….)))))))))).).)).)))(((((…..)))))………..
RS 2 seq AUGAGAUCAAGGGGAGAGACUGCAAAGGUUUUAGUAGUUUUAAGCUAUAAACUAUUAAAAACUGAGGCUUUUUAGCCUAUCUGCAGCGCCGAAGGAGCAAGCGUAUAAUCGUGAAUCUCUCAGGCAAAAAGACUCUUGUUUGACG
RS 2 dot .((((((…(((..((((..((…((((((((((((((……..)))))))))))).))…)).))))..))))))).))..(((…((((…(((……)))….))))..)))….((((….))))….
RS 3 seq UAGUUGCCAUAGCUCCGAGUUUGACGGGCUAAGUUCCGGAUGGAAUAGGCUUGUUAAACCUGUGGUCGAUGUUGAUGACCCGAGGGUGGGAUUGGAAAUGAUCUCGCCUCCCGUGUUUGGAAAGGUGUUCCAUGGCUCAAUUU
RS 3 dot ..((((((((((……((((((((((((..(((((….))))).)))))))))))))))))).))))……(((.((.(((((((((((….)))))))))).).)).)))(((((…..)))))………..

Back to Ensemble of 20 Table

Back to Ensemble of 1 Table